Cochlearia officinalis
speciesAt a glance
Occurrence records29 152
Data sources15
Biological traits44
DNA specimens40
eDNA detections23
Sources15 archives
Databases and archives Cochlearia officinalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility29 151 records↗
OBISOcean Biodiversity Information System1 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources44 traits
Chemical compositionLOTUS · NPASS78 compounds
Occurrence & distributionGBIF · OBIS29 152 records
Environmental DNA1 datasets · 4 countries23 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB · GoaT · NCBI812 Mbp
01Narrative
La cochléaire officinale est une espèce de plantes à fleurs de la famille des Brassicacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology15
Fruit length4 mm
Fruit length max5 mm
Fruit length min3 mm
Leaf length10 mm
Leaf length max15 mm
Leaf length min5 mm
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · GIFT: 155 mm²
Plant height0.241 m
⚠ sources differ — GIFT: 0.241 m · TRY: 0.105 m
Plant height generative0.3 m
Plant height max0.4 m
Plant height min0.1 m
Seed length1.35 mm
Seed mass0.493 mg
⚠ sources differ — TRY: 0.493 mg · LEDA: 0.484 mg · GIFT: 0.519 mg
Seed mass max0.78 mg
Seed mass min0.32 mg
Life cycle & reproduction14
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: autochor · GIFT: hydrochorous
Flowering endJun
Flowering startDec
Life formbiennial or perennial
Life spanperennial
⚠ sources differ — TRY: Perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number21
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)142 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)24.95 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Monocarpymonocarp
03Chemical composition78 compounds
Compounds documented for Cochlearia officinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Piperidine alkaloids25
N-acyl amines8
Cinnamic acids and derivatives3
Bisabolane sesquiterpenoids3
Furofuranoid lignans2
Documented compounds78 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2S,5R,6S)-2,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-5-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide | present | NPASS | |
| (1S,2R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-3-ene-1,2-diol | present | NPASS | |
| (1S,2S,5R,6R)-5,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-2-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide | present | NPASS | |
| (1S,4R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol | present | NPASS | |
| (1S,4R,5R,6S)-N-(2-methylpropyl)-6-[(E)-3-(2-methylpropylamino)-3-oxoprop-1-enyl]-4,5-dipentylcyclohex-2-ene-1-carboxamide | present | NPASS | |
| (2E,12E)-13-(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)trideca-2,12-dienamide | present | NPASS | |
| (2E,4E)-5-(1,3-benzodioxol-5-yl)-N-(3-methylbutyl)penta-2,4-dienamide | present | NPASS | |
| (2E,4E)-5-(1,3-benzodioxol-5-yl)-N-[(2R)-2-methylbutyl]penta-2,4-dienamide | present | NPASS | |
| (2E,4E)-5-(2H-1,3-benzodioxol-5-yl)-N-[(5E)-10-methylundec-5-en-1-yl]penta-2,4-dienamide | present | NPASS | |
| (2E,4E,12Z)-N-(2-Methylpropyl)-2,4,12-octadecatrienamide | present | NPASS |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cochlearia officinalis has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes6
GenBank sequences10
eDNA detections23
Countries4
The DNA barcodea real sequence read deposited for this species
CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGTCCAAAACAGTACGACCCGAGAACAACTGATCATCACTCTCGG …
Cochlearia officinalis isolate 1543 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL5★rbcLa★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Cochlearia officinalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size811 740 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cochlearia officinalis0.81 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records12–362n range24median24mode77records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2452×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Fearn, G.M. New Phytol. 79: 455-458 (1977)
CCDB · brit-fl — Gill, J.J.B. Genetica 44: 217-234 (1973)
CCDB · brit-fl — Saunte, L.H. Hereditas (Lund) 41: 499-515 (1955)
CCDB · brit-fl — Gill, J.J.B., McAllister, H.A., Fearn, G.M. Watsonia 12: 15-21 (1978)
CCDB · brit-fl — Crane, M.B., Gairdner, A.E. J. Genet. 13: 187-200, pl.vi-ix (1923)
CCDB · brit-fl — Fearn, G.M. Watsonia 11: 142-143 (1976)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2338
CCDB · fl-europaea — Saunte, 1955
CCDB · ipcn-api-dl — Koch, M., H. Hurka & K. Mummenhoff. 1997. Chloroplast DNA restriction site variation and RAPD-analyses in Cochlearia (Brassicaceae): Biosystematics and speciation. Nordic J. Bot. 16(6): 585–603.
CCDB · ipcn-api-dl — PEGTEL, D. M. 1999. Effect of ploidy level on fruit morphology, seed germination and juvenile growth in scurvy grass (Cochlearia officinalis L. s.l., Brassicaceae). Pl. Spec. Biol. 14: 201–215.
CCDB · ipcn-api-dl — Gupta, P. P. 1981. Consequences of artifical and natural chromosome doubling on DNA, RNA and protein contents in Cochlearia (Brassicaceae). Pl. Syst. Evol. 138: 23–27.
CCDB · ipcn-api-dl — FEARN, G. M. 1977a. A morphological and cytological investigation of Cochlearia populations on the Gower Peninsula, Glamorgan. New Phytol. 79: 455–458.
CCDB · ipcn-api-dl — GILL, J. J. B. 1976. Cytogenetic studies in Cochlearia L. (Cruciferae). The chromosomal constitution of C. danica L. Genetica 46: 115–127.
CCDB · ipcn-api-dl — Gill, L. S. 1978. New chromosome numbers in the family Labiatae. Sci. & Cult. 44: 273–274.
CCDB · ipcn-api-dl — Koch, M., M. Huthmann & H. Hurka. 1998. Isozymes, speciation and evolution in the polyploid complex Cochlearia L. (Brassicaceae). Bot. Acta 111: 411–425.
CCDB · book-ipcn72 — ENGELSKJOEN, T., & G. KNABEN. 1971. Chromosome numbers of Scandinavian arctic-alpine plant species. III. Acta Boreal., A, Scientia No. 28: 1-30.
CCDB · book-ipcn67-71 — LAANE, M. M. 1967. KromosomundersBkelser i Cst-Finnmarks flora. II. (Chromosome numbers in the flora of eastern Finmark. II.) ,Blyttia 25: 45-54.
CCDB · book-ipcn75-78 — Fearn 1977a
CCDB · book-ipcn75-78 — Gill et al. 1978
CCDB · book-ipcn75-78 — Gill 1976
CCDB · book-northern-plants — Biicher 1938 a.
CCDB · book-ipcn73-74 — GILL, J.J.B. 1974. Cytogenetic studies in Cochlearia L. (Cruciferael The origins of C. officinalis L and f micacea Marshall. Genetica 44: 217-233.
CCDB · brass — Gill
CCDB · brass — Koch et al.
CCDB · brass — Vogt
CCDB · brass — Gupta
CCDB · brass — Pegtel
CCDB · brass — Laane
CCDB · brass — Engelskjn & Knaben
CCDB · CromoCat 2015 — Böcher, T. W. (1938b). Zur Zytologie einiger arktischen und borealen Blütenpflanzen. Svensk Bot. Tidskr. 32(3): 346-361.
CCDB · CromoCat 2015 — Rohner, P. (1954). Zytologische untersuchungen an einigen schweizerischen hemioreophyten. Mitt. Naturf. Ges. Bern 11: 43-107.
CCDB · CromoCat 2015 — Saunte, L. H. (1955). Cytogenetical studies in the Cochlearia officinalis complex. Hereditas 41: 499-515.
CCDB · CromoCat 2015 — Koch, M., Huthmann, M. & Hurka, H. (1998). Isozymes, speciation and evolution in the polyploid complex Cochlearia L. (Brassicaceae). Bot. Acta 111: 411–425
2n 148×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-fedorov +2
CCDB · ipcn-api-dl — Volkova, S. A., E. V. Boyko & I. V. Antusheva. 2003. Chromosome numbers of some species of Kamchatka and Sakhalin flora. Bot. Žhurn. (Moscow & Leningrad) 88(9): 154–155.
CCDB · book-ipcn73-74 — PETROVA, 0.0. 1974. Caryotype of Agropyron lavrenkoanum Prokud. Ukrajins'k. Bot. zurn. 31: 367-369.
CCDB · book-fedorov — Flovik 1940
CCDB · book-fedorov — Mosquin, Hayley 1966 tristis
CCDB · brass — Bcher & Larsen
CCDB · brass — Volkova et al.
CCDB · brass — Packer & McPherson
CCDB · CromoCat 2015 — Volkova, S. A., E. V. Boyko & I. V. Antusheva (2003). Chromosome numbers of some species of Kamchatka and Sakhalin flora Bot. Žhurn. (Moscow & Leningrad) 88(9): 154–155
2n 287×CCDB · book-northern-plants · CCDB · book-fedorov · CCDB · brass +1
CCDB · book-northern-plants — Crane & Gairdner 1923.
CCDB · book-fedorov — Crane, Gairdner 1923 Der. ta
CCDB · book-fedorov — Tischler 1934, 1937
CCDB · book-fedorov — Wulff 1937a
CCDB · book-fedorov — Bocher 1938a
CCDB · brass — Crane & Gairdner
CCDB · book-atlas-flowering-plants — Crane & G., 1923
2n 123×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ipcn-api-dl — Vogt, R. 1985. Die Cochlearia pyrenaica-Gruppe in Zentraleuropa. Ber. Bayer. Bot. Ges. 56: 5–52.
CCDB · CromoCat 2015 — Vogt, R. (1985). Die Cochlearia pyrenaica-Gruppe in Zentraleuropa. Berichte der Bayerischen Botanischen Gesellschaft zur Erforschung der Heimischen Flora 56: 5-52
2n 363×CCDB · book-ipcn67-71 · CCDB · book-fedorov · CCDB · brass
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-fedorov — Gadella, Kliphuis 1966
CCDB · brass — Gadella & Kliphuis
2n 262×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Fearn, G.M. New Phytol. 79: 455-458 (1977)
2n 181×CCDB · brass
CCDB · brass — Rohner
2n 321×CCDB · kew
CCDB · kew — Lysák MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. 2009. The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular Biology and Evolution 26: 85-98.
n 1211×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · brass +1
CCDB · ipcn-api-dl — Nordal, I. & M. M. Laane. 1996. Taxonomic delimitation within Cochlearia officinalis s. lat. with particular discussion on the rank of C. anglica (Brassicaceae). Symb. Bot. Upsal. 31(3):47–57.
CCDB · book-ipcn73-74 — GILL, J.J.B. 1973. Cytogenetic studies in Cochlearia L. (Cruciferae). The origins of C. officinalis L. and f. micacea Marshall. Genetica 44 217-234. I
CCDB · book-ipcn73-74 — GILL, J.J.B. 1974. Cytogenetic studies in Cochlearia L. (Cruciferael The origins of C. officinalis L and f micacea Marshall. Genetica 44: 217-233.
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · brass — Bcher
CCDB · brass — Laane
CCDB · brass — Nordal & Laane
CCDB · brass — Rohner
CCDB · brass — Fearn
CCDB · CromoCat 2015 — Laane, M. M. (1971). Chromosome numbers in Norwegian vascular plant species 6. Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Nordal, I. & M. M. Laane (1996). Taxonomic delimitation within Cochlearia officinalis s. lat. with particular discussion on the rank of C. anglica (Brassicaceae) Symb. Bot. Upsal. 31(3):47–57
n 73×CCDB · book-ipcn66 · CCDB · brass
CCDB · book-ipcn66 — Mosquin & Hayley 1966
CCDB · brass — Mosquin & Hayley
CCDB · brass — Holmen
n 142×CCDB · brass
CCDB · brass — Tischler
CCDB · brass — Wulff
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Nordal, I. & M. M. Laane (1996). Taxonomic delimitation within Cochlearia officinalis s. lat. with particular discussion on the rank of C. anglica (Brassicaceae) Symb. Bot. Upsal. 31(3):47–57
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.659 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness47.9% BUSCO
08Occurrence & distribution
Record type29 152 records
Wild obs. + sensor27 074
Museum / vouchered2 020
Cultivated / captive46
Other12
Origin
Native3 907
Introduced34
Range
Area of Occupancy AOO40 632 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy59% within 1 km
≤100 m 8 099≤1 km 7 379≤10 km 10 676>10 km 132
26 286 georeferenced · 788 without coordinates
Open the mapobservation + sensor27 074
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 264≤1 km 249≤10 km 230>10 km 123
866 georeferenced · 1 154 without coordinates
Open the institutions mapphysical evidence2 020
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 18>10 km 24
42 georeferenced · 4 without coordinates
Open the mapnot free-living46
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions57 of 107 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 315 |
| Olocation not on record | 210 |
| DAOlocation not on record | 203 |
| DBF-NHMDlocation not on record | 142 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 109 |
| KMNlocation not on record | 79 |
| Garðabær, IS | 75 |
| Oskarshamn, SE | 72 |
| MeiseBGlocation not on record | 55 |
| Brussel, BE | 46 |
| Trondheim, NO | 41 |
| TROMlocation not on record | 40 |
| WTUlocation not on record | 35 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 30 |
| Zürich, CH | 27 |
| 26 | |
| South Kensington, GB | 24 |
| Moscow State Universitylocation not on record | 20 |
| Tsukuba, JP | 19 |
| Zürich, CH | 15 |
| UGentlocation not on record | 15 |
| Uppsala, SE | 15 |
| SLU Artdatabankenlocation not on record | 14 |
| University of Birminghamlocation not on record | 12 |
| Bern, CH | 12 |
| Tromso University Museumlocation not on record | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 12 |
| Bergen, NO | 10 |
| Chongqing Museumlocation not on record | 10 |
| Vancouver, CA | 9 |
| Bronx, US | 8 |
| Kandalaksha State Nature Reservelocation not on record | 8 |
| Kew, GB | 8 |
| Provincia di Livornolocation not on record | 6 |
| University of Stellenboschlocation not on record | 6 |
| BSBIlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Oulu, FI | 6 |
| Wlocation not on record | 5 |
| Turku, FI | 5 |
| Porrentruy, CH | 4 |
| Porvoo, FI | 4 |
| Jyväskylä, FI | 4 |
| Wellington, NZ | 4 |
| Montréal, CA | 4 |
| Anchorage, US | 3 |
| BClocation not on record | 3 |
| Barcelona, ES | 3 |
| Frankfurt am Main | 3 |
| Acadia Universitylocation not on record | 3 |
| Beijing, CN | 3 |
| Stockholm, SE | 3 |
| BRNUlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Saint Louis, US | 2 |
| PRClocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Kuopio, FI | 2 |
| Salzburg, AT | 2 |
| Mlocation not on record | 2 |
| Wuzhou, CN | 2 |
| BDBClocation not on record | 2 |
| Dresden, DE | 2 |
| Trois-Rivières, CA | 2 |
| Universität Basel, Herbariumlocation not on record | 2 |
| Ischia Marine Centrelocation not on record | 2 |
| Buenos Aires, AR | 1 |
| Sion, CH | 1 |
| Plocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Yangling, CN | 1 |
| 中国极地研究中心location not on record | 1 |
| Provo, US | 1 |
| Helsinki, FI | 1 |
| Bourges, FR | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Baroda, IN | 1 |
| Citadel Hill, GB | 1 |
| MAlocation not on record | 1 |
| Tilburg, NL | 1 |
| BFLlocation not on record | 1 |
| València, ES | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| nbflocation not on record | 1 |
| GB | 1 |
| Karlsruhe, DE | 1 |
| Dekalb, US | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Denver, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Arcata, US | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| PTHlocation not on record | 1 |
| Pullman, US | 1 |
| Riverside, US | 1 |
| Phoenix, US | 1 |
| Görlitz, DE | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Claremont, US | 1 |
| Rovaniemi, FI | 1 |
| Mississippi State, US | 1 |
| Salamanca, ES | 1 |
| Paris, FR | 1 |
107 institutions · 1 880 of 2 020 vouchered records shown · 140 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Cochlearia officinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map4 countries0
base of sea cliff
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.50 °C 4.70–13.2
Seasonal swing summer↔winter14.4 °C
Max temp (day)10.8 °C 6.00–17.1
Min temp (night)7.50 °C 2.00–10.2
Precipitation82.6 mm/mo 59.7–125
Air humidity64.3 % 61.4–69.1
Moisture balance12.1 mm/mo
Vapour deficit415 Pa 266–606
Wind speed5.60 m/s
Cloud cover56.7 % 47.0–64.9
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.