Coccus viridis

(Green, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coccidae/Coccus

At a glance

Occurrence records229

Data sources7

Biological traits0

DNA specimens23

eDNA detections23

Sources7 archives

Databases and archives Coccus viridis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF229 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Coccus viridis is a soft scale insect in the family Coccidae with a wide host range. It is commonly known as green scale or sometimes coffee green scale because it is a major pest of coffee crops throughout the world.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coccus viridis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs4

Marker genes2

eDNA detections23

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)2.3%

Haplotypes1

BINs3

Where individuals differ — all 95 variable positions, in barcode order

12Cmostly conserved

18Tmostly conserved

22Cmostly conserved

31Amostly conserved

32Amostly conserved

33Tmostly conserved

35Amostly conserved

38Cmostly conserved

39Amostly conserved

51Cmostly conserved

56Tmostly conserved

57Amostly conserved

60Amostly conserved

66Tmostly conserved

78Tmostly conserved

87Amostly conserved

88Tmostly conserved

91Cmostly conserved

102Tmostly conserved

120Tmostly conserved

130Gmostly conserved

131Tmostly conserved

135Cmostly conserved

138Amostly conserved

141Cmostly conserved

147Amostly conserved

153Amostly conserved

154Tmostly conserved

162Tmostly conserved

165Gmostly conserved

168Cmostly conserved

183Cmostly conserved

186Cmostly conserved

189Amostly conserved

192Amostly conserved

198Tmostly conserved

204Amostly conserved

205Amostly conserved

214Cmostly conserved

216Tmostly conserved

222Amostly conserved

226Tmostly conserved

228Amostly conserved

232Amostly conserved

242Tmostly conserved

253Gmostly conserved

255Amostly conserved

261Cmostly conserved

267Cmostly conserved

282Amostly conserved

291Cmostly conserved

300Tmostly conserved

309Cmostly conserved

311Amostly conserved

314Cmostly conserved

318Tmostly conserved

321Tmostly conserved

330Tmostly conserved

333Tmostly conserved

339Tmostly conserved

345Cmostly conserved

346Cmostly conserved

354Gmostly conserved

355Cmostly conserved

360Amostly conserved

363Tmostly conserved

366Tmostly conserved

375Amostly conserved

387Amostly conserved

390Tmostly conserved

397Cmostly conserved

416Tmostly conserved

423Tmostly conserved

424Tmostly conserved

432Cmostly conserved

433Cmostly conserved

435Cmostly conserved

436Tmostly conserved

438Amostly conserved

439Cmostly conserved

447Tmostly conserved

456Cmostly conserved

462Tmostly conserved

481Amostly conserved

483Amostly conserved

486Cmostly conserved

492Tmostly conserved

507Gmostly conserved

513Amostly conserved

528Cmostly conserved

529Cmostly conserved

534Cmostly conserved

537Tmostly conserved

559Amostly conserved

561Gmostly conserved

AGAATAATTATCCGAATTGAACTAATAAATAATAAAACAAACTTTAATTTCAATTTAACATATTATATAATAATTACTATTCATGCATTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eucalymnatus tessellatussame family13.1%Ceroplastes ruscisame family13.9%Parthenolecanium cornisame family14.6%Ceroplastes ceriferussame family14.8%Ceroplastes sinensissame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type229 records

Wild obs. + sensor197

Museum / vouchered32

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 74≤1 km 26≤10 km 25>10 km 42

167 georeferenced · 30 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MWLRlocation not on record	15
Universidad Nacional de Colombia (UNAL)location not on record	9
DPIlocation not on record	6
Australian National Fish Collectionlocation not on record	2

4 institutions · 32 of 32 vouchered records shown

09Environmental DNA23 detections

Where the DNA of Coccus viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–14.4

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.8 °C 15.8–18.9

Min temp (night)3.60 °C 3.60–9.10

Precipitation10.4 mm/mo 10.4–169

Air humidity48.1 % 48.1–56.9

Moisture balance-73.1 mm/mo -73.1–77.7

Vapour deficit636 Pa 636–693

Wind speed4.20 m/s 2.60–4.20

Cloud cover18.1 % 18.1–33.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)