Coccothrinax readii

H.J.Quero · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Coccothrinax

At a glance

Occurrence records2 727

Data sources6

Biological traits24

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Coccothrinax readii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 727 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF2 727 records

DNA & barcodingNCBIsequences

01Narrative

Coccothrinax readii, the Mexican silver palm, is a palm which is native to southeastern Mexico and northeastern Belize. Henderson and colleagues (1995) considered C. readii to be a synonym of Coccothrinax argentata.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length9.15 mm

Fruit length max10 mm

Fruit length min8.3 mm

Fruit width8.75 mm

Fruit width max12.5 mm

Fruit width min5 mm

Leaf length max2 200 mm

Plant height6 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits4

Dbh max8.5 cm

Defenseno

Shoot length max600 cm

Shoot orientationerect

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coccothrinax readii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692031.1 ↗483 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Coccothrinax readii voucher SCBG170 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 727 records

Wild obs. + sensor2 581

Museum / vouchered146

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 29≤1 km 3≤10 km 3>10 km 2

37 georeferenced · 2 544 without coordinates

Open the mapobservation + sensor2 581

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 112≤10 km 6

118 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mérida, MX	69
Durango, MX	23
Mexico City, MX	17
Miami, US	12
Tapachula, MX	12
Ciudad de México, MX	5
Saint Louis, US	2
Austin, US	1
Bronx, US	1
Galeano, G."location not on record	1
Kew, GB	1
Anchorage, US	1

12 institutions · 145 of 146 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coccothrinax readii

At a glance

Sources6 archives

Size & morphology8

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

Other traits4

At a glance

Record type2 727 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 12 geolocated

Record type2 727 records