Coccothrinax miraguama — The Life Data

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Coccothrinax

At a glance

Occurrence records52

Data sources6

Biological traits23

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Coccothrinax miraguama's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF52 records

DNA & barcodingNCBIsequences

01Narrative

Coccothrinax miraguama is a palm which is endemic to Cuba. Three subspecies are recognised: C. miraguama subsp. havanensis, C. miraguama subsp. miraguama, and C. miraguama subsp. roseocarpa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length12.7 mm

Fruit width12.7 mm

Leaf length max1 500 mm

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 15 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits6

Dbh max20 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coccothrinax miraguama has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692019.1 ↗482 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Coccothrinax miraguama voucher XMBG199 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL3ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type52 records

Wild obs. + sensor8

Museum / vouchered44

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤1 km 2>10 km 6

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	28
Bronx, US	2
MeiseBGlocation not on record	1
Montréal, CA	1

4 institutions · 32 of 44 vouchered records shown · 12 without an institution code