Coccinella magnifica

Redtenbacher, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Coccinella

At a glance

Occurrence records5 561

Data sources7

Biological traits2

DNA specimens21

eDNA detections161

Sources7 archives

Databases and archives Coccinella magnifica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 561 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI161 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 561 records

Environmental DNA4 datasets · 9 countries161 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT≈499 Mbp

01Narrative

Coccinella magnifica, also known as the scarce seven-spot ladybird, is a species of beetle in the family Coccinellidae. Both the adults and larvae are predators. They are known for their diet of aphids, but will eat many other pests such as soft-scale insects, spider mites, mealybugs, and the eggs of many others. A single larvae will eat about 400 medium size aphids during its development to pupal stage. An adult will eat about 300 aphids before it lays its eggs. Approximately 3 to 10 aphids are eaten for each egg laid, and a female will lay from 50 to 300 eggs in her lifetime. More than 5,000 aphids may be eaten by a single adult ladybug in its lifetime. The scarce 7-spot is often found along with nests of wood ants.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coccinella magnifica has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes2

eDNA detections161

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

10Tmostly conserved

79Gmostly conserved

127Tmostly conserved

181Gmostly conserved

205Tmostly conserved

316Amostly conserved

433Gmostly conserved

448Tmostly conserved

466Gmostly conserved

508Gmostly conserved

520Amostly conserved

532Tmostly conserved

592Amostly conserved

597Tmostly conserved

621Tmostly conserved

AACTTTATATTTTTTATTTGGTATATGAGCAGGTATAATTGGAACATCATTAAGAATTTTAATTCGACTAGAACTAGGGACTACTAATAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes4

BINs2

Most divergent pair2.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coccinella novemnotatasame genus6.7%Coccinella johnsonisame genus6.8%Coccinella californicasame genus7.0%Coccinella monticolasame genus8.7%Coccinella fulgidasame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Coccinella magnifica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈498 771 620 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Coccinella magnifica0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98% BUSCO

08Occurrence & distribution

Record type5 561 records

Wild obs. + sensor5 010

Museum / vouchered533

Cultivated / captive18

Origin

Native36

Range

Area of Occupancy AOO12 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 2 010≤1 km 1 848≤10 km 711>10 km 36

4 605 georeferenced · 405 without coordinates

Open the mapobservation + sensor5 010

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 105≤1 km 107≤10 km 159>10 km 17

388 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence533

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the mapnot free-living18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	85
Paris, FR	46
Zürich, CH	26
NTNU-VMlocation not on record	20
Helsinki, FI	17
Tartu, EE	13
Bern, CH	12
Oulu, FI	12
Trondheim, NO	11
Muzeum Górnośląskie w Bytomiulocation not on record	11
Brussel, BE	11
Metsähallituslocation not on record	11
Olocation not on record	11
NHMOlocation not on record	8
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
Adam Mickiewicz University in Poznańlocation not on record	6
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	6
MZLUlocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
NMOKlocation not on record	5
BioFokuslocation not on record	4
Dhaka, BD	4
Tilburg, NL	4
Tallinn, EE	3
Kuopio, FI	3
Philadelphia, US	3
South Kensington, GB	3
CBDClocation not on record	2
NMBU:MINAlocation not on record	2
ZSMlocation not on record	2
Stockholm, SE	2
neflocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Tromsø, NO	1
NCMGlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

37 institutions · 369 of 533 vouchered records shown · 164 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA161 detections

Where the DNA of Coccinella magnifica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found161

Studies independent surveys4

Countries9

Verifiable raw sequence linked143

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 161 detections have coordinates

Open the map9 countries0

fieldHalbtrockenrasenWaldrand

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 10.9–17.4

Seasonal swing summer↔winter18.4 °C

Max temp (day)19.2 °C 15.2–21.8

Min temp (night)10.8 °C 6.40–13.9

Precipitation58.0 mm/mo 40.7–75.9

Air humidity59.0 % 58.0–61.4

Moisture balance-55.0 mm/mo -83.1–-25.3

Vapour deficit698 Pa 550–811

Wind speed3.10 m/s 2.40–3.80

Cloud cover43.0 % 38.6–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 159 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coccinella magnifica

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 561 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 561 records