Clupeonella abrau

(Maliatsky, 1930) · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Clupeidae/Clupeonella

At a glance

Occurrence records22

Data sources9

Biological traits6

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Clupeonella abrau's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD3 specimens

01Narrative

Abrau sprat, Clupeonella abrau, is a species of freshwater fish in the family Clupeidae. It is found landlocked in Russia in a single locality, Lake Abrau, located at 70 m above sea level near the Black Sea coast close to Novorossiysk. The lake is small and has been stocked by several alien species, whence the Abrau sprat is considered critically endangered. A sprat of the Lake Apolyont in Turkey, linked to the Sea of Marmara, was earlier treated as a subspecies of the Abrau sprat, Clupeonella abrau muhilisi, but has more recently been considered an independent species Clupeonella muhlisi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length9.5 cm

Life cycle & reproduction1

Max. longevity24 months

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

Uses & economy1

Commercial importancesubsistence fisheries

Other traits1

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clupeonella abrau has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P669 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.60%

Haplotypes2

BIN1

Most divergent pair0.90%

Where individuals differ — all 6 variable positions, in barcode order

183Gvariable

282Avariable

474Gvariable

546Tvariable

558Cvariable

657Gvariable

GATATTGGCACCCTATACCTAGTGTTTGGTGCCTGAGCGGGAATGGTAGGCACAGCCCTGAGTCTACTAATCCGAGCAGAACTTAGTCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Opisthonema libertatesame order15.6%Sprattus sprattussame family15.8%Ramnogaster melanostomasame family16.0%Dorosoma analesame order16.0%Opisthonema medirastresame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_086922 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type22 records

Museum / vouchered22

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	10

1 institutions · 10 of 22 vouchered records shown · 10 without an institution code

09Environmental DNA2 detections

Where the DNA of Clupeonella abrau was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 13.5–13.5

Seasonal swing summer↔winter20.8 °C

Max temp (day)16.4 °C

Min temp (night)10.8 °C

Precipitation47.3 mm/mo

Air humidity59.6 %

Moisture balance-27.6 mm/mo

Vapour deficit626 Pa

Wind speed4.10 m/s

Cloud cover49.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)