Clitoria heterophylla

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Clitoria

At a glance

Occurrence records126

Data sources5

Biological traits8

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Clitoria heterophylla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF126 records

DNA & barcodingNCBIsequences

01Narrative

Clitoria heterophylla là một loài thực vật có hoa trong họ Đậu. Loài này được Lam. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass14.0 mg

Life cycle & reproduction1

Life formscrambling perennial or subshrub

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clitoria heterophylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKX652124.1 ↗1 847 bpMadagascar

ACGT

ATGAAGGAATATCAAGTATATTTAGAACTCGATAGTTCTCACCACCAGGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGG …

Clitoria heterophylla voucher D.J. Du Puy M441 (MO) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type126 records

Wild obs. + sensor8

Museum / vouchered118

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced · 4 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	58
Kew, GB	19
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	9
Saint Louis, US	8
Plocation not on record	6
Stockholm, SE	2
MeiseBGlocation not on record	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	1
LDlocation not on record	1
University of Stellenboschlocation not on record	1
Uppsala, SE	1

11 institutions · 108 of 118 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)