Clitocybe sclerotoidea

(Morse) H.E.Bigelow · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Clitocybe

At a glance

Occurrence records179

Data sources6

Biological traits0

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Clitocybe sclerotoidea's data was compiled from.

GBIFGlobal Biodiversity Information Facility179 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF179 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clitocybe sclerotoidea has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ271771.1 ↗292 bpUSA · 1937

ACGT

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTCTGGCTTTTGTTAGTCCGTC …

Clitocybe sclerotoidea isolate MICH CIB A. H. Smith 8666 voucher MICH:184497 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type179 records

Wild obs. + sensor126

Museum / vouchered53

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 33≤1 km 26≤10 km 41>10 km 11

111 georeferenced · 15 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 1≤1 km 7≤10 km 15>10 km 4

27 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	24
Ann Arbor, US	9
Vancouver, CA	4
Bronx, US	3
California State University, East Baylocation not on record	3
University of Tennessee at Chattanoogalocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
TENN-Flocation not on record	1
ILLSlocation not on record	1

9 institutions · 49 of 53 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Clitocybe sclerotoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

ShrublandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 5.40–14.4

Seasonal swing summer↔winter10.4 °C

Max temp (day)13.1 °C 8.80–19.1

Min temp (night)6.60 °C 2.20–11.2

Precipitation240 mm/mo 68.4–326

Air humidity64.7 % 60.1–67.3

Moisture balance199 mm/mo -46.2–285

Vapour deficit444 Pa 310–611

Wind speed2.40 m/s 1.60–3.10

Cloud cover54.0 % 29.3–59.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)