Clematis paniculata

J.F.Gmel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records4 102

Data sources7

Biological traits24

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Clematis paniculata's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF4 102 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf length max130 mm

Plant height1.5 m

Seed length4.1 mm

Seed length max4.1 mm

Seed length min4.1 mm

Seed mass6.4 mg

Seed mass max6.4 mg

Seed mass min6.4 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Life formclimber

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Sex typedioecious

Habitat & environment5

Climatesubtropical

Climberobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: vine

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis paniculata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ499135.1 ↗545 bpNew Zealand

ACGT

TCGATACCTGCCCAGCAGAACGACCCGCGAACACGTGAAAGCAACCACACGCAGGGACGCCCTGCCAACAGGCAGGACGGCCCTCCTAAC …

Clematis paniculata from New Zealand internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type4 102 records

Wild obs. + sensor3 602

Museum / vouchered499

Cultivated / captive1

Origin

Native25

Introduced2

Range

Area of Occupancy AOO9 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 2 500≤1 km 361≤10 km 138>10 km 64

3 063 georeferenced · 539 without coordinates

Open the mapobservation + sensor3 602

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 9≤1 km 8≤10 km 29>10 km 6

52 georeferenced · 447 without coordinates

Open the institutions mapphysical evidence499

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	161
Wellington, NZ	114
Christchurch, NZ	88
Rotorua, NZ	26
Museo Entomologico de Leonlocation not on record	23
Xining, CN	7
Wuhan, CN	5
Hobart, AU	4
Shanghai, CN	4
Ann Arbor, US	3
nlocation not on record	2
MeiseBGlocation not on record	2
Zhejiang Universitylocation not on record	2
Northeastern Forestry Universitylocation not on record	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Obihiro Centennial City Museumlocation not on record	1
Tampa, US	1
Mount Annan, AU	1
Port Elizabeth Museum (Bayworld)location not on record	1
Uppsala, SE	1
Capital Normal Universitylocation not on record	1
WNNUlocation not on record	1
Chongqing Natural History Museumlocation not on record	1
Toronto, CA	1
Nanjing, CN	1
Cambridge University Herbariumlocation not on record	1

26 institutions · 454 of 499 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Clematis paniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Clematis paniculata

At a glance

Sources7 archives

Size & morphology8

Life cycle & reproduction9

Habitat & environment5

Physiology & chemistry2

At a glance

Record type4 102 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 102 records