Clematis morefieldii

Kral · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records74

Data sources8

Biological traits5

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Clematis morefieldii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Clematis morefieldii is a rare species of flowering plant in the buttercup family known by the common names Morefield's leather flower and Huntsville vasevine. It is endemic to northern Alabama and southern Tennessee, where it is known from about 22 populations currently, most of which are small.USFWS. Clematis morefieldii Five-year Review. September 2007. Many of the populations are threatened, and some have been recently extirpated. It is a federally listed endangered species, listed in 1992.USFWS. Endangered status determined for the plant Clematis morefieldii (Morefield's leather flower. Federal Register May 20, 1992.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formliana

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis morefieldii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM593689.1 ↗546 bpUSA · 2014

ACGT

AGCGAGTGTTGGCTTCAAAGCAGGTGTTAAAGAGTACAAATTGAATTATTATACTCCTGAATATGAACCCAAAGAAACTGATACCTTGGC …

Clematis morefieldii isolate DNAS-88-72353 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor69

Museum / vouchered5

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 69

69 georeferenced

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	3
Chicago, US	1

2 institutions · 4 of 5 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Clematis morefieldii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–15.6

Seasonal swing summer↔winter20.5 °C

Max temp (day)20.6 °C

Min temp (night)11.6 °C

Precipitation121 mm/mo

Air humidity58.2 %

Moisture balance9.60 mm/mo

Vapour deficit809 Pa

Wind speed3.70 m/s

Cloud cover40.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)