Clematis macropetala

Ledeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records440

Data sources10

Biological traits25

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Clematis macropetala's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility440 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF440 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Clematis macropetala is a species of Clematis native to northwestern China, Mongolia, and adjoining areas of Siberia. Its cultivars 'Ballet Skirt', 'Lagoon', 'Pauline', and 'Wesselton' have gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length5 mm

Fruit length max5 mm

Fruit length min5 mm

Fruit width2.5 mm

Fruit width max3 mm

Fruit width min2 mm

Inflorescence length max12.5 cm

Inflorescence length min8 cm

Leaf length36.25 mm

Leaf length max50 mm

Leaf length min20 mm

Leaf width17.5 mm

Leaf width max25 mm

Leaf width min10 mm

Plant height2 m

Life cycle & reproduction5

Flowering endJun

Flowering startMay

Life formclimber

Life spanperennial

Lifespan years5 years

Habitat & environment5

Climatetemperate

Climberobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Habitat GIFTforest, mountains, stony places

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis macropetala has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW383276.1 ↗583 bpChina · 2020

ACGT

TTGCATGCGGCAGGTCTTGTCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCGGGGACACGCGCCCCGGTC …

Clematis macropetala internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis macropetala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Gong, W. Z., Y. Y. Long & M. X. Li. 1985. Karyotype studies on Clematis from Beijing, China. J. Wuhan Bot. Res. 3(4): 371–379.

CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.

CCDB · book-ipcn67-71 — PRINGLE, J,S, 1969. Documented plant chromosome numbers 1969: 1. Sida 3: 350-351.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type440 records

Wild obs. + sensor80

Museum / vouchered359

Cultivated / captive1

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 34≤1 km 16≤10 km 5>10 km 10

65 georeferenced · 15 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1≤10 km 2>10 km 1

5 georeferenced · 354 without coordinates

Open the institutions mapphysical evidence359

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	113
Yangling, CN	61
Xining, CN	37
Beijing Normal Universitylocation not on record	17
Institute of Applied Ecology, Academia Sinicalocation not on record	16
Nanjing, CN	13
Lanzhou, CN	11
Moscow State Universitylocation not on record	9
Northeastern Forestry Universitylocation not on record	8
Kunming, CN	8
Tianjin Natural History Museumlocation not on record	6
Shanxi Institute of Biologylocation not on record	6
Chengdu, CN	5
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	4
Peking Universitylocation not on record	4
Edinburgh, GB	3
Inner Mongolia Universitylocation not on record	3
SMMUlocation not on record	2
Beijing, CN	2
Jiangxi College of Educationlocation not on record	2
Xian, CN	2
Guangzhou, CN	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Siouxland Heritage Museumlocation not on record	2
Saint Louis, US	1
Chongqing Museumlocation not on record	1
SLU Artdatabankenlocation not on record	1
Chengdu, CN	1
Zhengzhou, CN	1
Bothell, US	1
Capital Normal Universitylocation not on record	1
Xian, CN	1
ENTClocation not on record	1
Kew, GB	1
Awka, NG	1
Shenzhen, CN	1
CASlocation not on record	1
Tampa, US	1
LDlocation not on record	1
Central China Agricultural Universitylocation not on record	1
Stockholm, SE	1

41 institutions · 355 of 359 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Clematis macropetala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)