Clematis lasiantha

Nutt. ex Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records3 291

Data sources8

Biological traits18

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Clematis lasiantha's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 291 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF3 291 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.89 mg

Seed mass max4.36 mg

Seed mass min3.23 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typewind

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

Physiology & chemistry4

Leaf n14.8 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)13.65 mm²/mg

Wood density580 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis lasiantha has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU732601.1 ↗588 bp

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCGGGGG …

Clematis lasiantha voucher Janeway9366 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis lasiantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · eflora · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-fedorov — Meurman, Therman 1939 M

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 291 records

Wild obs. + sensor3 150

Museum / vouchered141

Range

Area of Occupancy AOO3 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 866≤1 km 318≤10 km 146>10 km 60

2 390 georeferenced · 760 without coordinates

Open the mapobservation + sensor3 150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 10≤1 km 65≤10 km 30>10 km 2

107 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	60
San Luis Obispo, US	28
Long Beach, US	13
Santa Cruz, US	12
Beijing, CN	4
Tampa, US	4
Wuzhou, CN	3
Vancouver, CA	2
Oskarshamn, SE	2
EL PASO, US	2
Cambridge, US	2
San Diego, US	2
Riverside, US	1
San Juan College School of Science Math & Engineeringlocation not on record	1
Ensenada, MX	1
San Diego Natural History Museum, Herbariumlocation not on record	1
US	1
Auckland, NZ	1
MeiseBGlocation not on record	1

19 institutions · 141 of 141 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Clematis lasiantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Post 7/03 Coyote fire recovery chapparal: mt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 17.2–17.2

Seasonal swing summer↔winter15.4 °C

Max temp (day)25.2 °C

Min temp (night)10.2 °C

Precipitation9.30 mm/mo

Air humidity53.6 %

Moisture balance-158 mm/mo

Vapour deficit917 Pa

Wind speed1.70 m/s

Cloud cover26.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Clematis lasiantha

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 291 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 291 records