Clematis koreana

Kom. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records328

Data sources8

Biological traits26

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Clematis koreana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility328 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF328 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Clematis koreana is een Clematis-soort uit de Atragene groep die van nature in de bergen en heuvels van Noordoost-China, Noord- en Zuid-Korea en Oost-Siberië op een hoogte van 300–2000 m voorkomt. Ze groeit daar in de struiklaag van gemengde bossen met eiken, esdoorns en sparren, vaak samen met rhododendrons. De wetenschappelijke naam is voor het eerst in 1901 geldig gepubliceerd door de Russische botanicus Vladimir Leontjevitsj Komarov.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length5 mm

Fruit length max5 mm

Fruit length min5 mm

Fruit width3 mm

Fruit width max3 mm

Fruit width min3 mm

Inflorescence length max11 cm

Inflorescence length min8 cm

Leaf length75 mm

Leaf length max90 mm

Leaf length min60 mm

Leaf width60 mm

Leaf width max70 mm

Leaf width min50 mm

Seed mass6.97 mg

Life cycle & reproduction3

Life formclimbing shrub

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment8

Climatetemperate

Climberfacultative

Elevation max1 900 m

Elevation mean1 450 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

03Chemical composition2 compounds

Compounds documented for Clematis koreana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols1

Gallotannins $ Simple phenolic acids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Gallic acid		present	LOTUS
Quercetin 3-rutinoside		present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis koreana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU853306.1 ↗415 bp

ACGT

ATCAAAACCCGGCGCGACAAGCGTCAAGGAAAACTTAGCGGAAACAAGGGGCCGGCCCGTCACAGGGACGACCCCAAGAATCCGAATACT …

Clematis koreana isolate 952 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis koreana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · book-ipcn67-71 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn67-71 — LEE, Y.N. 1970. Chromosome number of flowering plants in Korea (3) J. Korean Res. Inst. Better Living 5: 127-129.

CCDB · book-fedorov — Meurman, Therman 1939

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type328 records

Wild obs. + sensor92

Museum / vouchered231

Cultivated / captive5

Origin

Introduced2

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 92 records without

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 44≤10 km 38

82 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence231

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KR	60
Kyoto Universitylocation not on record	30
Herbarium of the Department of Botany, University of Tokyolocation not on record	26
Servico de Microbiologia e Imunologialocation not on record	25
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	11
Institute of Applied Ecology, Academia Sinicalocation not on record	10
Tsukuba, JP	9
Beijing, CN	6
Elocation not on record	6
Cambridge, US	5
Plocation not on record	5
Ann Arbor, US	4
Northeastern Forestry Universitylocation not on record	3
Saint Louis, US	3
National Institute of Biological Resourceslocation not on record	2
ENTClocation not on record	2
Siouxland Heritage Museumlocation not on record	2
Nanjing, CN	2
Kew, GB	2
Kunming, CN	1
Yangling, CN	1
Moscow State Universitylocation not on record	1
Oulu, FI	1
J. Rusek Collectionlocation not on record	1
MeiseBGlocation not on record	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Stockholm, SE	1
Vitebsk State University named after P.M. Masherovlocation not on record	1
Philadelphia, US	1

29 institutions · 223 of 231 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)