Clematis integrifolia

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records3 287

Data sources11

Biological traits35

DNA specimens5

eDNA detections2

Sources11 archives

Databases and archives Clematis integrifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 287 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF3 287 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

La Clématite à feuilles entières ou Clématite solitaire est une espèce de plantes de la famille des Renonculacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology19

Fruit length8.5 mm

Fruit length max10 mm

Fruit length min7 mm

Fruit width4.5 mm

Fruit width max5 mm

Fruit width min4 mm

Inflorescence length max16 cm

Inflorescence length min5 cm

Leaf length105 mm

Leaf length max140 mm

Leaf length min70 mm

Leaf size2 027 mm²

Leaf width85 mm

Leaf width max110 mm

Leaf width min60 mm

Plant height1.25 m

⚠ sources differ — GIFT: 1.25 m · TRY: 0.8 m

Plant height max1.5 m

Plant height min0.3 m

Seed mass6.9 mg

Life cycle & reproduction5

Flowering endJul

Flowering startJun

Life formperennial or subshrub

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest edges, shrubberies, steppe

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)253 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)18.27 mm²/mg

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis integrifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences9

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG236881.1 ↗295 bpCanada · 1920

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCTTCAGACCGAGGGCACGTCTGCCTGGGCGTCACACACA …

Clematis integrifolia voucher 7616HIM 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis integrifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1611×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · ipcn-api-dl — Serov, V. P. 1986. Chromosome numbers in some representatives of the Clematideae (Ranunculaceae) tribe of the USSR flora. Bot. Zhurn. 71: 1428.

CCDB · ipcn-api-dl — Serov, V. P. 1989. The study of karyotypes in representatives of the genera Clematis and Atragene (Ranunculaceae). Bot. Žhurn. (Moscow & Leningrad) 74: 967–972.

CCDB · ipcn-api-dl — Pringle, J. S. 1979. Documented plant chromosome numbers 1979: 1. Sida 8: 119–120.

CCDB · ipcn-api-dl — BHATTACHARJEE, A. & A. K. Sharma. 1980. Karyological investigations on three genera of Ranunculaceae. Acta Bot. Indica 8: 1–10.

CCDB · book-ipcn67-71 — KEENER, C. s. 1967. A biosystematic study of Clematis subsection Integrifoliae (Ranunculaceael. Jour. Elisha Mitchell Sci. soc. 83: 1-41.

CCDB · book-ipcn75-78 — Magulaev 1976

CCDB · book-fedorov — Meurman. Therman 1939 .

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-atlas-flowering-plants — Meurman & T. 1939

CCDB · Cave1962 — Kurita 1962a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 287 records

Wild obs. + sensor2 597

Museum / vouchered634

Cultivated / captive7

Other49

Origin

Introduced5

Range

Area of Occupancy AOO6 256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 096≤1 km 259≤10 km 126>10 km 79

1 560 georeferenced · 1 037 without coordinates

Open the mapobservation + sensor2 597

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 19≤1 km 116≤10 km 207>10 km 11

353 georeferenced · 281 without coordinates

Open the institutions mapphysical evidence634

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 4 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	172
Vitebsk State University named after P.M. Masherovlocation not on record	111
BRNUlocation not on record	20
GJOlocation not on record	19
LDlocation not on record	17
Voronezh State Universitylocation not on record	14
Wlocation not on record	11
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	9
Oskarshamn, SE	9
Adam Mickiewicz University in Poznańlocation not on record	7
Denver, US	7
GZUlocation not on record	5
Beijing, CN	5
Bern, CH	4
Tampere, FI	4
Bronx, US	4
Provincia di Livornolocation not on record	3
Tampa, US	3
Urumqi, CN	3
Görlitz, DE	3
Karlsruhe, DE	2
Auckland, NZ	2
Xian, CN	2
University of Guelph, OAC Herbariumlocation not on record	2
Saint Louis, US	2
BClocation not on record	2
PRClocation not on record	1
Mlocation not on record	1
SZUlocation not on record	1
Olocation not on record	1
Bangkok, TH	1
Uppsala, SE	1
Wellington, NZ	1
Kew, GB	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Kunming, CN	1
Boumlocation not on record	1
Vancouver, CA	1
Podgorica, ME	1
Chengdu, CN	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
MAlocation not on record	1
Salzburg, AT	1
BFLlocation not on record	1

44 institutions · 460 of 634 vouchered records shown · 172 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Clematis integrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.10 °C -3.50–15.7

Seasonal swing summer↔winter28.8 °C

Max temp (day)11.1 °C 1.10–21.1

Min temp (night)2.20 °C -6.80–11.2

Precipitation78.9 mm/mo 77.5–80.2

Air humidity60.2 % 57.6–62.9

Moisture balance-2.90 mm/mo -56.3–50.5

Vapour deficit521 Pa 223–818

Wind speed3.30 m/s 2.80–3.80

Cloud cover51.4 % 43.2–59.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Clematis integrifolia

At a glance

Sources11 archives

Size & morphology19

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 287 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 44 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 287 records