Clematis fremontii

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records507

Data sources9

Biological traits12

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Clematis fremontii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility507 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF507 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Clematis fremontii is a species of flowering plant in the buttercup family known as Fremont's leather flower. It is endemic to the United States where it is known from several disjunct populations throughout the central and southeastern states.Clematis fremontii. Flora of North America. Previously unknown populations were discovered in the mid-2000s in Tennessee and Georgia.Clematis fremontii. NatureServe.Clematis fremontii. USDA NRCS Plant Fact Sheet. Other names for this plant include Fremont's crowsfoot, Fremont's leather-plant, leatherplant, and rattleweed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Plant height0.311 m

Plant height generative0.269 m

Seed mass7.97 mg

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Physiology & chemistry2

Leaf C:N ratio149 g/g

Leaf dry-matter content (LDMC)298 mg/g

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis fremontii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSKR909792.1 ↗600 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAAACCACACGCAGGGA …

Clematis fremontii voucher TUR:601952 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis fremontii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · book-ipcn67-71 · CCDB · eflora · CCDB · book-fedorov

CCDB · book-ipcn67-71 — KEENER, C. s. 1967. A biosystematic study of Clematis subsection Integrifoliae (Ranunculaceael. Jour. Elisha Mitchell Sci. soc. 83: 1-41.

CCDB · eflora

CCDB · book-fedorov — Gregory W. C. 1941

n 82×CCDB · ipcn-api-dl · CCDB · book-ipcn66

CCDB · ipcn-api-dl — Freeman, C. C. & R. E. Brooks. 1988. Documented plant chromosome numbers 1988: 1. Chromosome counts for North American plants -- I. Sida 13: 241–250.

CCDB · book-ipcn66 — Keener 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type507 records

Wild obs. + sensor327

Museum / vouchered180

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 132≤1 km 37≤10 km 7>10 km 75

251 georeferenced · 76 without coordinates

Open the mapobservation + sensor327

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 4≤1 km 38≤10 km 54>10 km 19

115 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	89
Saint Louis, US	16
Bronx, US	15
Emporia, US	7
Chongqing Museumlocation not on record	7
Chadron, US	5
University of Tennessee at Chattanoogalocation not on record	5
Denver, US	5
Brookings, US	5
Knoxville, US	4
Auckland, NZ	2
Bloomington, US	2
Flagstaff, US	1
Chicago, US	1
Beijing, CN	1
Philadelphia, US	1
Tampa, US	1
Jena Microbial Resource Collectionlocation not on record	1
Riverside, US	1
Davenport, US	1
GB	1
PHlocation not on record	1
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	1
New Haven, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Edmonton, CA	1

26 institutions · 176 of 180 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)