Clematis cirrhosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records5 510

Data sources11

Biological traits17

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Clematis cirrhosa's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 510 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF5 510 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB9.3 Gbp

01Narrative

Clematis cirrhosa is a species of flowering plant in the family Ranunculaceae, native to the Mediterranean. It includes the 'Freckles', 'Wisley Cream' and 'Jingle Bells' cultivars, with 'Freckles' and 'Wisley Cream' having gained the Royal Horticultural Society's Award of Garden Merit. It is also one of 8 subdivisions in the Thorncroft Clematis catalogue, published in 2000.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height4.75 m

Seed mass2.54 mg

⚠ sources differ — TRY: 2.54 mg · GIFT: 3.28 mg

Seed mass max3.54 mg

Seed mass min3.02 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formclimber

Life spanperennial

Lifespan years10 years

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density380 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis cirrhosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT113314.1 ↗553 bpIsrael · 2018

ACGT

GCGGAAGGATCATTGTCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCAGGGACCCTAGCGGGGACCTGCC …

Clematis cirrhosa var. cirrhosa isolate 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis cirrhosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size9 330 120 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Clematis cirrhosa9.33 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1612×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +2

CCDB · ita-fl — ROMANO S., MAZZOLA P., RAIMONDO F.M. - 1987. Numeri cromosomici per la flora italiana: 1106-1117.. Inform. Bot. Ital. , 19(2): 173-180.

CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 162-182. Cardona, M. A. & J. Contandriopoulos.Lagascalia9(2): 272-284(1980).

CCDB · ipcn-api-dl — Romano, S., P. Mazzola & F. M. Raimondo. 1987. Numeri cromosomici per la flora Italiana: 1106--1117. Inform. Bot. Ital. 19: 173–180.

CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.

CCDB · ipcn-api-dl — Cardona, M. A. & J. Contandriopoulos. 1980. In Numeros cromosomicos para la flora EspaPSola. 121-182. Lagascalia 9: 249-284.

CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.

CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.

CCDB · CromoCat 2015 — Romano, S., P. Mazzola & F. M. Raimondo. (1987). Numeri cromosomici per la flora Italiana: 1106--1117. Inf. Bot. Ital. 19: 173-180.

CCDB · CromoCat 2015 — Runemark, H. (2000). Mediterranean chromosome number reports-10. Fl. Medit. 10: 386-402.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 510 records

Wild obs. + sensor4 935

Museum / vouchered430

Cultivated / captive2

Other143

Origin

Native65

Introduced10

Range

Area of Occupancy AOO10 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 1 355≤1 km 316≤10 km 655>10 km 72

2 398 georeferenced · 2 537 without coordinates

Open the mapobservation + sensor4 935

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 18≤1 km 48≤10 km 68>10 km 2

136 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence430

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	77
BIO-UNIPIlocation not on record	50
MAlocation not on record	38
BClocation not on record	27
UIBlocation not on record	24
Barcelona, ES	19
CJBGlocation not on record	14
Sevilla, ES	13
València, ES	13
Rishon Le Zion, IL	13
Granada, ES	10
Wlocation not on record	10
College of the Atlantic, Museumlocation not on record	9
EEZA-CSIClocation not on record	8
Kew, GB	7
Alicante, ES	7
Institut und Museum fuer Geologie und Palaeontologielocation not on record	7
Museo della Bonifica di San Donà di Piavelocation not on record	7
Berlin, DE	5
Salamanca, ES	5
Christchurch, NZ	5
Badajoz, ES	4
Phyletisches Museum Jenalocation not on record	4
Dresden, DE	3
Hunan Geological Museumlocation not on record	3
Saint Louis, US	3
Moscow State Universitylocation not on record	3
Entomological Society of Latvialocation not on record	3
Auckland, NZ	2
Córdoba, ES	2
Adam Mickiewicz University in Poznańlocation not on record	2
JBSlocation not on record	2
Santa Barbara, US	2
Bourges, FR	2
Boumlocation not on record	2
Madrid, ES	2
Oskarshamn, SE	1
ESP145location not on record	1
Frankfurt am Main	1
Bratislava, SK	1
BRNUlocation not on record	1
Vancouver, CA	1
Turku, FI	1
Namur, BE	1
Madrid, ES	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Paris, FR	1
GZUlocation not on record	1
SNSNMClocation not on record	1

49 institutions · 420 of 430 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Clematis cirrhosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Clematis cirrhosa

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment5

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type5 510 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type5 510 records