Clematis brachiata

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records2 749

Data sources8

Biological traits21

DNA specimens8

eDNA detections4

Sources8 archives

Databases and archives Clematis brachiata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 749 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF2 749 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Clematis brachiata, commonly known as traveller's joy, is a hardy, deciduous Southern African liana of the family Ranunculaceae. It tends to clamber to the tops of trees and shrubs, sprawling over the crowns. Leaves are compound with from 1 to 7 leaflets. Attractive fragrant flowers appear in summer. Achenes are covered in fine silky hair. This species is common in the northern parts of South Africa and kwaZulu-Natal and was first described by Carl Peter Thunberg (1743-1828), the celebrated Swedish naturalist. "Clema" is Greek for a liane, and the Latin specific name "brachiata" means "provided with arms" since the right-angled and opposite branching habit resembles arms sticking out of a torso.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height3.5 m

⚠ sources differ — GIFT: 3.5 m · TRY: 4 m

Plant height max6.09 m

Plant height min0.5 m

Seed mass1.74 mg

Seed mass max1.86 mg

Seed mass min1.46 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formclimber

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Elevation max2 125 m

Elevation min0 m

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis brachiata has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences9

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU732580.1 ↗590 bp

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCAGGGA …

Clematis brachiata voucher Wen11065 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type2 749 records

Wild obs. + sensor2 065

Museum / vouchered682

Cultivated / captive1

Other1

Range

Area of Occupancy AOO6 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 455≤1 km 181≤10 km 54>10 km 27

1 717 georeferenced · 348 without coordinates

Open the mapobservation + sensor2 065

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 4≤1 km 24≤10 km 5>10 km 1

34 georeferenced · 648 without coordinates

Open the institutions mapphysical evidence682

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	390
Durban, ZA	95
Cape Town, ZA	20
National Museums of Kenyalocation not on record	18
MeiseBGlocation not on record	14
TAFORI-LSRClocation not on record	13
Kew, GB	11
LNBG$location not on record	10
Instituto de Investigação Científica Tropicallocation not on record	9
Zürich, CH	5
University of Stellenboschlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Saint Louis, US	3
Baroda, IN	3
Bronx, US	3
Tampa, US	3
MSB-3054location not on record	3
South Kensington, GB	2
Moscow State Universitylocation not on record	2
Coimbra, PT	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Uppsala, SE	1
Chongqing Museumlocation not on record	1
Plocation not on record	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
University of Johannesburglocation not on record	1
GHPG$location not on record	1
South African National Biodiversity Institutelocation not on record	1
Philadelphia, US	1

30 institutions · 623 of 682 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Clematis brachiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 17.4–21.3

Seasonal swing summer↔winter11.6 °C

Max temp (day)26.7 °C 24.3–26.7

Min temp (night)13.1 °C 11.1–15.3

Precipitation63.2 mm/mo 49.8–71.8

Air humidity55.4 % 51.0–56.5

Moisture balance-86.2 mm/mo -97.0–-67.8

Vapour deficit1,118 Pa 904–1,163

Wind speed3.00 m/s 2.50–4.20

Cloud cover16.8 % 14.9–27.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Clematis brachiata

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

At a glance

Record type2 749 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 749 records