Clematis baldwinii

Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Clematis

At a glance

Occurrence records563

Data sources7

Biological traits5

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Clematis baldwinii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility563 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF563 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Clematis baldwinii là một loài thực vật có hoa trong họ Mao lương. Loài này được Torr. & A.Gray mô tả khoa học đầu tiên năm 1838.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clematis baldwinii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR909796.1 ↗604 bp

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAAACCACACGCAGGG …

Clematis baldwinii voucher TUR:601943 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clematis baldwinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn73-74 · CCDB · eflora

CCDB · book-ipcn73-74 — KEENER, C.S. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type563 records

Wild obs. + sensor442

Museum / vouchered121

Range

Area of Occupancy AOO1 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 230≤1 km 80≤10 km 22>10 km 40

372 georeferenced · 70 without coordinates

Open the mapobservation + sensor442

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 5≤10 km 10>10 km 23

38 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	51
Miami, US	21
Jena Microbial Resource Collectionlocation not on record	19
Bloomington, US	7
Chongqing Museumlocation not on record	6
Bronx, US	4
Saint Louis, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
US	1
Brookings, US	1
Burlington, US	1
Valdosta State Universitylocation not on record	1

12 institutions · 117 of 121 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)