Cleistocactus baumannii

(Lem.) Lem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Cleistocactus

At a glance

Occurrence records429

Data sources9

Biological traits15

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Cleistocactus baumannii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility429 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Occurrence & distributionGBIF429 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

miniatur|Cleistocactus baumannii subsp. horstii Cleistocactus baumannii ist eine Pflanzenart in der Gattung Cleistocactus aus der Familie der Kakteengewächse (Cactaceae). Das Artepitheton baumannii ehrt den französisch-deutschen Gärtner Constantin Auguste Napoléon Baumann (1804–1884), der seine Gärten in Mulhouse und Bollwiller hatte.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsucculent subshrub or shrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation mean1 350 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTVegetação Sobre Afloramentos Rochosos

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cleistocactus baumannii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKJX683877.1 ↗2 461 bp

ACGT

GTGCGGCTAGGATCTTTTACATATTTGGATGAAGCAAGGAATTCGTCTACATCATCGGTAGAGTTTATCAGACCACGACTGATCCTGAAA …

Cleistocactus baumannii isolate E441 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cleistocactus baumannii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ross, R. 1981. Chromosome counts, cytology and reproduction in the Cactaceae. Amer. J. Bot. 68: 463–470.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type429 records

Wild obs. + sensor300

Museum / vouchered129

Origin

Native9

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 114≤1 km 63≤10 km 24>10 km 2

203 georeferenced · 97 without coordinates

Open the mapobservation + sensor300

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 3≤1 km 1≤10 km 4>10 km 1

9 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	37
Bronx, US	21
UFMSlocation not on record	7
Castelar, AR	7
Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record	7
Paleontological Collectionlocation not on record	6
San Isidro, AR	5
Buenos Aires, AR	4
Kew, GB	4
Corrientes, AR	4
Santa Cruz de la Sierra, BO	4
GAlocation not on record	3
La Paz, BO	2
Paris, FR	2
Phoenix, US	2
Philadelphia, US	2
CJBGlocation not on record	2
South Kensington, GB	2
Universidad Nacional de Asunciónlocation not on record	2
Tampa, US	1
Riverside, US	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
MeiseBGlocation not on record	1
UNICAMPlocation not on record	1
Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record	1

25 institutions · 129 of 129 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)