Cleistanthus cunninghamii

(Müll.Arg.) Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Cleistanthus

At a glance

Occurrence records1 393

Data sources7

Biological traits33

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Cleistanthus cunninghamii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 393 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cleistanthus cunninghamii là một loài thực vật có hoa trong họ Diệp hạ châu. Loài này được (Müll.Arg.) Müll.Arg. mô tả khoa học đầu tiên năm 1866.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length6.5 mm

Fruit width6.5 mm

Leaf length60 mm

Leaf length max90 mm

Leaf length min30 mm

Leaf mass per area71.89 g/m2

Leaf size1 134 mm²

⚠ sources differ — TRY: 1 134 mm² · AusTraits: 1 884 mm²

Leaf width30 mm

Leaf width max40 mm

Leaf width min20 mm

Petiole length0.65 cm

Plant height17.5 m

Seed length3.5 mm

Seed mass19.23 mg

Seed width2.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnyyyyy

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: Tree

Leaf compoundnesssimple

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)15.64 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cleistanthus cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895814.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Cleistanthus cunninghamii voucher 1076420449 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type1 393 records

Wild obs. + sensor896

Museum / vouchered289

Cultivated / captive1

Other207

Origin

Native69

Range

Area of Occupancy AOO3 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 746≤1 km 30≤10 km 20>10 km 13

809 georeferenced · 87 without coordinates

Open the mapobservation + sensor896

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 79≤1 km 21≤10 km 95>10 km 54

249 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence289

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	113
Mount Annan, AU	69
Museo Entomologico de Leonlocation not on record	47
Armidale, AU	15
Smithfield, AU	13
Canberra, AU	12
Kew, GB	5
Hobart, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wellington, NZ	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Adelaide, AU	1

12 institutions · 279 of 289 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cleistanthus cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cleistanthus cunninghamii

At a glance

Sources7 archives

Size & morphology15

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

At a glance

Record type1 393 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 393 records