Cleistanthus collinus

(Roxb.) Benth. ex Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Cleistanthus

At a glance

Occurrence records44

Data sources13

Biological traits10

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Cleistanthus collinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS31 compounds

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Cleistanthus collinus is a plant species first described by Roxburgh, with its current name after Bentham and Hooker; it is included in the family Phyllanthaceae. The IUCN categorizes this species as vulnerable. No subspecies are listed in the Catalogue of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition31 compounds

Compounds documented for Cleistanthus collinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Arylnaphthalene and aryltetralin lignans23

Furofuranoid lignans4

Unsaturated fatty acids3

Stigmastane steroids1

Carotenoids (C40, β-β)1

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(3S)-9-(1,3-benzodioxol-5-yl)-4-hydroxy-3,6,7-trimethoxy-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
(3S,3aS,4S,6S,6aR)-3,6-bis(1,3-benzodioxol-5-yl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-4-ol	present	LOTUS
(8aR)-5-(1,3-benzodioxol-5-yl)-8a,9-dihydro-8H-[2]benzofuro[6,5-f][1,3]benzodioxol-6-one	present	LOTUS
(R)-dyphylline	present	LOTUS
9-(1,3-benzodioxol-5-yl)-4-[(2R,3R,4R,5R)-3-hydroxy-4,5-dimethoxyoxan-2-yl]oxy-6,7-dimethoxy-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
9-(1,3-benzodioxol-5-yl)-4-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-methoxyoxan-2-yl]oxy-6,7-dimethoxy-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
9-(1,3-benzodioxol-5-yl)-4-[3,4-dihydroxy-5-(5-hydroxy-3,4-dimethoxyoxan-2-yl)oxy-6-(hydroxymethyl)oxan-2-yl]oxy-6,7-dimethoxy-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
9-(1,3-Benzodioxol-5-yl)-4-hydroxy-6,7-dimethoxynaphtho(2,3-c)furan-1(3H)-one	present	LOTUS
9-(1,3-benzodioxol-5-yl)-5-[(2R,3R,4R,5R)-3-hydroxy-4,5-dimethoxyoxan-2-yl]oxy-6H-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one	present	LOTUS
beta-Sitosterol	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cleistanthus collinus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLKF381126.1 ↗582 bp

ACGT

AAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGACTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATA …

Cleistanthus collinus isolate TMP45 ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cleistanthus collinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Bedi, Y. S., S. S. Bir & B. S. Gill. 1981. In Chromosome number reports LXXI. Taxon 30:153.

CCDB · book-indian_vol1 — Datta, N. 1967; Sarkar, A.K. & Datta, N. 1980

n 103×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & V. K. Singhal. 1981. Cytomorphological studies in north Indian pomegranate (Punica granatum Linn.). J. Cytol. Genet. 16: 35–45.

CCDB · ipcn-api-dl — Bedi, Y. S., S. S. Bir & B. S. Gill. 1981. In Chromosome number reports LXXI. Taxon 30:153.

CCDB · ipcn-api-dl — Sarkar, A. K. & N. Datta. 1980. Cytological assessment of the family Euphorbiaceae. II. Tribe Phyllantheae. Proc. Indian Sci. Congr. Assoc. (III, C) 67: 48–49.

n 111×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DATTA, N. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350-:-

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.928 ↗

08Occurrence & distribution

Record type44 records

Wild obs. + sensor23

Museum / vouchered21

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 21

21 georeferenced · 2 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 2≤10 km 6

8 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	8
Pondicherry, IN	5
Dehra Dun, IN	4

3 institutions · 17 of 21 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Cleistanthus collinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)