Claytonia sarmentosa

C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Montiaceae/Claytonia

At a glance

Occurrence records517

Data sources8

Biological traits13

DNA specimens15

eDNA detections9

Sources8 archives

Databases and archives Claytonia sarmentosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility517 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF517 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 10

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.2 m

Plant height min0.1 m

Life cycle & reproduction4

Flowering endAug

Flowering startJul

Life formperennial or tuberous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claytonia sarmentosa has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes6

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG237066.1 ↗306 bpCanada · 2004

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Claytonia sarmentosa voucher CCDB-18333-F10 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★rbcLa★ITS2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Claytonia sarmentosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidypolyploid inferred

Chromosome records10–322n range12median10mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×CCDB · sys-botany · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71