Claytonia ogilviensis

Mc Neill · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Montiaceae/Claytonia

At a glance

Occurrence records29

Data sources6

Biological traits9

DNA specimens12

eDNA detections10

Sources6 archives

Databases and archives Claytonia ogilviensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI12 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claytonia ogilviensis has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG235473.1 ↗336 bpCanada · 2012

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Claytonia ogilviensis voucher CCDB-18357-F9 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor13

Museum / vouchered16

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 8>10 km 3

11 georeferenced · 2 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Research Collection of B. A. Bennettlocation not on record	9
Vancouver, CA	1

2 institutions · 10 of 16 vouchered records shown · 6 without an institution code

09Environmental DNA10 detections

Where the DNA of Claytonia ogilviensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

S-facing aspect 180AÂ°, mid-slope 30AÂ° with…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 2.10–12.5

Seasonal swing summer↔winter31.9 °C

Max temp (day)11.3 °C 6.20–16.3

Min temp (night)2.10 °C -2.00–8.00

Precipitation72.5 mm/mo 40.1–149

Air humidity56.9 % 55.4–61.3

Moisture balance-11.1 mm/mo -57.1–29.0

Vapour deficit463 Pa 279–634

Wind speed4.50 m/s 3.20–5.60

Cloud cover55.0 % 40.9–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)