Claytonia exigua

Douglas ex Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Montiaceae/Claytonia

At a glance

Occurrence records1 219

Data sources9

Biological traits13

DNA specimens13

eDNA detections7

Sources9 archives

Databases and archives Claytonia exigua's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 219 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 219 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Claytonia exigua is a species of wildflower known by the common names serpentine springbeauty and pale claytonia, in the family Montiaceae. It is native to western North America from British Columbia to Idaho to California, where it grows in a number of habitat types, including plant communities on serpentine soils.Miller, J. M. and K. L. Chambers. 2006. Systematics of Claytonia (Portulacaceae). Systematic Botany Monographs 78: 1-234.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.456 mg

Seed mass max0.456 mg

Seed mass min0.456 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claytonia exigua has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes5

GenBank sequences9

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ498075.1 ↗589 bp

ACGT

TCGATACCTGCCAAGCAGAACGACCCGTGGACAAGTTATACAACATGTGGGGATGAGAGCCTCGACTTCCTTCCTCACGTCTTGAGCGCA …

Claytonia exigua subsp. exigua internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Claytonia exigua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records16–482n range32median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · eflora

CCDB · eflora

2n 481×CCDB · book-ipcn66

CCDB · book-ipcn66 — Nilsson 1966b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 219 records

Wild obs. + sensor1 137

Museum / vouchered82

Origin

Native7

Range

Area of Occupancy AOO1 876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 720≤1 km 76≤10 km 37>10 km 29

862 georeferenced · 275 without coordinates

Open the mapobservation + sensor1 137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 1≤1 km 21≤10 km 11>10 km 2

35 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	11
Claremont, US	9
Tacoma, US	8
San Luis Obispo, US	8
US	5
Canadian Department of Agriculturelocation not on record	5
Vancouver, CA	3
Riverside, US	3
WTUlocation not on record	3
Santa Barbara, US	3
CASlocation not on record	2
University of British Columbialocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Los Angeles, US	2
Santa Cruz, US	2
Bronx, US	1
Arcata, US	1
Victoria, CA	1
Portland, US	1
Long Beach, US	1
Saint Louis, US	1
Davenport, US	1
University of British Columbia, Herbariumlocation not on record	1

23 institutions · 76 of 82 vouchered records shown · 6 without an institution code

09Environmental DNA7 detections

Where the DNA of Claytonia exigua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Chaparral and meadows mixed with Pinus jeffr…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 9.10–10.7

Seasonal swing summer↔winter11.8 °C

Max temp (day)12.8 °C 11.2–16.3

Min temp (night)6.70 °C 4.50–9.10

Precipitation44.7 mm/mo 38.2–79.4

Air humidity60.3 % 50.0–61.3

Moisture balance-11.9 mm/mo

Vapour deficit486 Pa 456–633

Wind speed3.50 m/s

Cloud cover43.3 % 35.8–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Claytonia exigua

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 219 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 219 records