Clavulina amethystina

(Bull.) Donk · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Clavulina

At a glance

Occurrence records159

Data sources8

Biological traits0

DNA specimens0

eDNA detections470

Sources8 archives

Databases and archives Clavulina amethystina's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI470 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF159 records

Environmental DNA3 datasets · 10 countries470 detections

DNA & barcodingNCBIsequences

01Narrative

Clavulina amethystina is a species of coral fungus in the family Clavulinaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clavulina amethystina has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections470

Countries10

The DNA barcodea real sequence read deposited for this species

ITSPV404188.1 ↗542 bpNorway · 2002

ACGT

GTGCTGGCTTTTTAAGCATGTGCACTCCTCAACTCTTATCCTATCCACCTGTGCACACCCTGTAGGCAGAAATGAGGAACAAATTTTGTT …

Clavulina amethystina voucher MA-Fungi 53142 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type159 records

Wild obs. + sensor66

Museum / vouchered86

Cultivated / captive4

Other3

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 7≤10 km 30>10 km 4

43 georeferenced · 23 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 3≤1 km 2≤10 km 28>10 km 7

40 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence86

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	13
Chicago, US	12
Kensington, AU	12
Helsinki, FI	6
Oulu, FI	5
Adam Mickiewicz University in Poznańlocation not on record	4
National Biodiversity Institute, Costa Ricalocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
BDBClocation not on record	3
Toronto, CA	2
Mexico City, MX	1
Gijón, ES	1
Mlocation not on record	1
WTUlocation not on record	1
Turku, FI	1
Hobart, AU	1
IPA/SPlocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Karlsruhe, DE	1
LDlocation not on record	1
Blacksburg, US	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
DPIlocation not on record	1
MAlocation not on record	1

25 institutions · 79 of 86 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA470 detections

Where the DNA of Clavulina amethystina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found470

Studies independent surveys3

Countries10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 470 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 2.40–16.1

Seasonal swing summer↔winter22.8 °C

Max temp (day)14.7 °C 3.80–20.1

Min temp (night)6.50 °C -0.5–12.6

Precipitation77.4 mm/mo 48.1–225

Air humidity62.2 % 58.4–69.2

Moisture balance7.00 mm/mo -49.5–130

Vapour deficit543 Pa 226–746

Wind speed3.30 m/s 2.20–5.10

Cloud cover43.7 % 30.5–62.6

CHELSA 1981–2010, ~9 km grid, at location & month of 464 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)