Clavicorona taxophila

(Thom) Doty · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Clavariaceae/Clavicorona

At a glance

Occurrence records571

Data sources8

Biological traits0

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Clavicorona taxophila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF571 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Клавикорона тиссовая — малораспространённый вид грибов из рода Клавикорона (Clavicorona). Его находки считают редкостью, особенно в Европе. Благодаря своей экологии и малым размерам, вид может остаться незамеченным. Сапротрофный гриб, его роль в экосистеме соответствует редуцентам — разрушение древесных и хвойных остатков, возвращение органического вещества в почву.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clavicorona taxophila has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ271722.1 ↗308 bpUSA · 1956

ACGT

GAACGCACCTTGCACCCTCTGGTATTCCGGAGGGTATGCCTGTTTGAGTGTCATTAATCTCTCAACGCAACAAGTTTATTCTTGCTTGTG …

Clavicorona taxophila isolate MICH CIB A. H. Smith 56949 voucher MICH:162147 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type571 records

Wild obs. + sensor461

Museum / vouchered108

Other2

Range

Area of Occupancy AOO1 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 204≤1 km 56≤10 km 92>10 km 43

395 georeferenced · 66 without coordinates

Open the mapobservation + sensor461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 6≤1 km 15≤10 km 19>10 km 1

41 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	13
Copenhagen, DK	12
TENN-Flocation not on record	11
Vancouver, CA	7
WTUlocation not on record	6
Toronto, CA	6
Catholic University of Pekinglocation not on record	5
California State University, East Baylocation not on record	3
Tilburg, NL	2
Université de Montréal Biodiversity Centrelocation not on record	2
Olocation not on record	2
Joensuu, FI	1
Acadia Universitylocation not on record	1
Turku, FI	1
Kuopio, FI	1
Royal Botanic Gardens, Kewlocation not on record	1
Mlocation not on record	1
Chicago, US	1
Gijón, ES	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Hobart, AU	1
Oulu, FI	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
SLU Artdatabankenlocation not on record	1

24 institutions · 82 of 108 vouchered records shown · 26 without an institution code

09Environmental DNA3 detections

Where the DNA of Clavicorona taxophila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.00 °C 4.50–8.60

Seasonal swing summer↔winter11.6 °C

Max temp (day)9.00 °C 7.00–13.1

Min temp (night)3.40 °C 1.00–4.90

Precipitation267 mm/mo 101–383

Air humidity63.6 % 58.9–66.0

Moisture balance215 mm/mo 67.3–339

Vapour deficit351 Pa 303–418

Wind speed2.90 m/s 2.10–4.80

Cloud cover49.9 % 49.0–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)