Claviceps zizaniae — The Life Data

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Clavicipitaceae/Claviceps

At a glance

Occurrence records11

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Claviceps zizaniae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF11 records

DNA & barcodingNCBIsequences

01Narrative

Claviceps zizaniae is a plant pathogen that causes ergot in the wild rice species Zizania aquatica and Z. palustris. Originally described in 1920 as Spermoedia zizaniae by Faith Fyles, it was transferred to Claviceps in 1959 by Maria E. Pantidou. The new combination, however, was not published validly as Pantidou "failed to provide a full and direct reference to the place of publication". The binomial was published validly by Scott Redhead and colleagues in 2009.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Claviceps zizaniae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Ergot alkaloids2

Documented compounds2 total

Compound	Class	Amount	Source
Ergocryptine		present	LOTUS
Ergocryptinine		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claviceps zizaniae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ133405.2 ↗1 257 bpCanada

ACGT

ATCATTACCGAGTTTACAACTCCCAAACCCACTGTGAACTTATACCCAAAACGTTGCCTCGGCGGGTTGTACCCTCGTCGACCTCCATGA …

Claviceps zizaniae ITS1, 5.8S rRNA ITS2 and partial 28S rRNA, strain CCM 8231

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type11 records

Wild obs. + sensor11

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 2>10 km 2

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.