Claviceps sorghi

B.G.P.Kulk., Seshadri & Hegde · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Clavicipitaceae/Claviceps

At a glance

Occurrence records2

Data sources11

Biological traits0

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Claviceps sorghi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS2 compounds

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈36 Mbp

01Narrative

Fig. 5 Full blown infection of Sorghum plant by C. sorghi Claviceps sorghi is a fungal plant pathogen beloging to the phylum Ascomycota in the kingdom Fungi- its anamorphic phase is known as sphacelia sorghi. This species was first found in In India in 1915 and officically recorded in 1948 . The Claviceps genus is known for their infection of cereal and millet crops. This particular species of Claviceps infects Sorghum- giving the fungus its name 'sorghi'. These species in Claviceps are known to produce ergot on their host, as a byproduct of their infection. This can cause the disease known as ergotism when the infected crop is consumed.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Claviceps sorghi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Ergot alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
9,10-Dihydroergosine		present	LOTUS
Mycenaaurin A		present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claviceps sorghi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW281794.1 ↗557 bpIndia

ACGT

ATCATTACCGAGTTTACACTCCCAAACCCCCATGTGAACCTCTACCGAACGTTGCCTCGGCGGGAAACGCGCCCCGGCCCGCACACCCCC …

Claviceps sorghi isolate CS2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Claviceps sorghi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 635 695 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Claviceps sorghi0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness91.5% BUSCO

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

09Environmental DNA3 detections

Where the DNA of Claviceps sorghi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)