Claviceps paspali

F.Stevens & J.G.Hall · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Clavicipitaceae/Claviceps

At a glance

Occurrence records417

Data sources10

Biological traits0

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Claviceps paspali's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility417 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF417 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈29 Mbp

01Narrative

Claviceps paspali est une espèce de champignons ascomycètes de la famille des Clavicipitaceae à distribution pan-tropicale. Ce champignon, proche de l'ergot du seigle, parasite exclusivement les espèces de graminées du genre Paspalum. Le champignon colonise les ovaires de ces plantes et provoque le développement de sclérotes, appelées « ergots », qui remplacent les graines. Ces sclérotes contiennent des mycotoxines dites « trémorgènes », qui contiennent un atome d'azote dans un noyau indol-diterpénoïde. Il s'agit entre autres de la paspaline et des paspalitrèmes A et B. Lorsqu'elles sont ingérées par des animaux de pâturage, notamment les bovins, mais aussi les ovins et les chevaux, ces substance provoquent le « tournis du paspalum », maladie nerveuse caractérisée par des symptômes de tremblements, hyperexcitabilité, incoordination, ataxie, dépression et paralysie, qui s'aggravent lorsque les animaux sont soumis à certains exercices. Ces symptômes sont parfois accompagnés de diarrhée et de polyurie.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition24 compounds

Compounds documented for Claviceps paspali across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ergot alkaloids10

Indole-Diterpenoid alkaloids (Penitrems)9

Aminoacids2

Hydroxy fatty acids $ Other Octadecanoids1

Quinoline alkaloids1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Agroclavine	present	LOTUS
(2S,4aS,4bR,6aS,12bS,12cS,14aS)-3,4,4a,4b,5,6,6a,7,12,12b,12c,13,14,14a-Tetradecahydro-alpha,alpha,4a,12b,12c-pentamethyl-2H-1-benzopyrano(5',6':6,7)indeno(1,2-b)indole-2-methanol	present	LOTUS
(3R,5bS,7aS,13bS,13cR,15aS)-2,3,5b,6,7,7a,8,13,13b,13c,14,15-Dodecahydro-5b-hydroxy-2,2,13b,13c-tetramethyl-4H-3,15a-epoxy-1-benzoxepino(6',7':6,7)indeno(1,2-b)indol-4-one	present	LOTUS
(6aR,9R)-7-methyl-4,6,6a,7,8,9-hexahydroindolo[4,3-fg]quinolin-7-ium-9-carboxylate	present	LOTUS
(8alpha)-9,10-Didehydro-8-hydroxy-6-methylergoline-8-methanol	present	LOTUS
(alphaR,4R,5R)-1,3,4,5-Tetrahydro-4-(methylamino)-alpha-(1-methylethenyl)benz(cd)indole-5-methanol	present	LOTUS
10-Hydroxy-trans-paspalic acid Amide	present	LOTUS
19-Hydroxy-11-(3-hydroxy-3-methylbut-1-enyl)-4,5,24,24-tetramethyl-25,26-dioxa-7-azaheptacyclo[21.2.1.01,20.04,19.05,16.06,14.08,13]hexacosa-6(14),8(13),9,11,20-pentaen-22-one	present	LOTUS
1H-Indole, 3-(3,7,11,15-tetramethylhexadeca-2,6,10,14-tetraenyl)-	present	LOTUS
Chanoclavine	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claviceps paspali has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences9

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOK326692.1 ↗561 bp

ACGT

GGGGTACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCACTGTGAACATATACCCCAAAACGTTGCCTCGGCGGTCGCTCC …

Claviceps paspali strain WL721 ITS DNA small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Claviceps paspali carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈29 206 133 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Claviceps paspali0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~49.2 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin49.2 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type417 records

Wild obs. + sensor45

Museum / vouchered366

Other6

Range

Area of Occupancy AOO1 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 25≤1 km 5≤10 km 1>10 km 5

36 georeferenced · 9 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 2≤1 km 11≤10 km 116>10 km 65

194 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence366

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	139
DPIlocation not on record	115
FLASlocation not on record	19
Auckland, NZ	15
Champaign, US	12
Bronx, US	11
Catholic University of Pekinglocation not on record	11
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	10
TENN-Flocation not on record	5
Chicago, US	4
Madison, US	4
Odawara, JP	3
Brown Universitylocation not on record	2
Hobart, AU	2
Parkville, AU	2
ILLSlocation not on record	2
Canberra, AU	2
Cincinnati, US	1
Pullman, US	1
Kensington, AU	1
California State University, East Baylocation not on record	1
BISHlocation not on record	1

22 institutions · 363 of 366 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Claviceps paspali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Other Urban/disturbed/developed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 12.1–12.1

Seasonal swing summer↔winter4.80 °C

Max temp (day)14.6 °C

Min temp (night)10.0 °C

Precipitation142 mm/mo

Air humidity66.0 %

Vapour deficit476 Pa

Cloud cover51.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)