Clavariadelphus unicolor — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Gomphales/Clavariadelphaceae/Clavariadelphus

At a glance

Occurrence records115

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Clavariadelphus unicolor's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility115 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF115 records

DNA & barcodingNCBIsequences

01Narrative

Clavariadelphus unicolor is a species of club fungus in the family Gomphaceae found in North America. Originally described in 1873 by Miles Joseph Berkeley and Henry William Ravenel as Craterellus unicolor, it was transferred to the genus Clavariadelphus by Edred John Henry Corner in 1950.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clavariadelphus unicolor has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ785315.1 ↗485 bpUSA · 2022

ACGT

AAGGATCATTACAGTACCAATTGGGTCGTTGCTCAAAGTAGCACGGCCCTCTATACACATACCCCATGTGCACCTTATTATCTATTACAG …

Clavariadelphus unicolor internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS5

fungal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor55

Museum / vouchered60

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 8≤1 km 15≤10 km 9>10 km 5

37 georeferenced · 18 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤1 km 14≤10 km 10>10 km 3

27 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	21
Chapel Hill, US	17
Ann Arbor, US	5
Colorado State Universitylocation not on record	4
Chicago, US	3
FLASlocation not on record	3
Pullman, US	2
Bronx, US	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Champaign, US	1
ILLSlocation not on record	1

11 institutions · 59 of 60 vouchered records shown · 1 without an institution code