Claustula fischeri — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Phallales/Claustulaceae/Claustula

At a glance

Occurrence records103

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Claustula fischeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF103 records

DNA & barcodingNCBIsequences

01Narrative

Claustula fischeri — вид грибів, що належить до монотипового роду Claustula.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claustula fischeri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX663118.1 ↗715 bpAustralia · 1994

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGCTGCAGTCTCTGAGAGGGTCTCGATGCCGGCCGGGGGCGAGAGGAGGGGGGGTTGTCC …

Claustula fischeri isolate FT0143 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor80

Museum / vouchered23

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 22≤1 km 12≤10 km 2>10 km 9

45 georeferenced · 35 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 1≤1 km 12≤10 km 2

15 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	10
Auckland, NZ	7
Hobart, AU	4
DPIlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

5 institutions · 23 of 23 vouchered records shown