Clarkia rhomboidea

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Clarkia

At a glance

Occurrence records3 520

Data sources8

Biological traits14

DNA specimens10

eDNA detections5

Sources8 archives

Databases and archives Clarkia rhomboidea's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 520 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF3 520 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 24

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.374 mg

Seed mass max0.55 mg

Seed mass min0.19 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clarkia rhomboidea has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG235408.1 ↗336 bpUSA · 1995

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCAATCATC …

Clarkia rhomboidea voucher CCDB-24905-H12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clarkia rhomboidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Gottlieb, L. D. 1995. The status of Clarkia mosquinii (Onagraceae). Madroño 42(1): 79–81.

CCDB · book-atlas-flowering-plants — Lewis 1951

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.972 ↗

08Occurrence & distribution

Record type3 520 records

Wild obs. + sensor2 936

Museum / vouchered584

Origin

Native118

Range

Area of Occupancy AOO8 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 665≤1 km 210≤10 km 147>10 km 112

2 134 georeferenced · 802 without coordinates

Open the mapobservation + sensor2 936

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 16≤1 km 167≤10 km 107>10 km 5

295 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence584

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	131
Riverside, US	86
WTUlocation not on record	77
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	74
Angwin, US	59
Santa Barbara, US	57
Davis, US	30
ASUlocation not on record	9
Missoula, US	9
Logan, US	7
San Luis Obispo, US	6
EL PASO, US	5
Severin-McDaniel Insect Collectionlocation not on record	4
Wuzhou, CN	3
Saint Louis, US	3
University of British Columbia, Herbariumlocation not on record	2
Turku, FI	2
Uniwersytet Jagiellońskilocation not on record	2
Vancouver, CA	2
Santa Cruz, US	2
Austin, US	1
Wellington, NZ	1
GB	1
Moscow State Universitylocation not on record	1
Frankfurt am Main	1
San Diego Natural History Museum, Herbariumlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
St. Paul, US	1
MAlocation not on record	1
Madison, US	1
Mexico City, MX	1
Flagstaff, US	1

32 institutions · 582 of 584 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Clarkia rhomboidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

In open Quercus garryana woodlandLoose cut-bank on north side of road into Bu…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 16.2–20.6

Seasonal swing summer↔winter20.2 °C

Max temp (day)24.2 °C 22.9–28.8

Min temp (night)10.8 °C 10.0–12.4

Precipitation26.5 mm/mo 7.30–49.2

Air humidity49.6 % 40.0–52.9

Moisture balance-128 mm/mo -213–-92.1

Vapour deficit1,057 Pa 878–1,478

Wind speed3.90 m/s 1.70–6.40

Cloud cover32.0 % 22.3–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Clarkia rhomboidea

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 520 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 520 records