Clarkia heterandra

(Torr.) F.H.Lewis & P.H.Raven · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Clarkia

At a glance

Occurrence records336

Data sources11

Biological traits10

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Clarkia heterandra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF336 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Clarkia heterandra is a species of flowering plant in the evening primrose family known by the common name mountain clarkia. It is endemic to California, where it is from the forests and woodlands of several of eastern and western mountain ranges. It is an annual herb producing an erect, glandular stem to around half a meter in maximum height. The lance-shaped to oval leaves are up to 8 centimeters long and are borne on petioles of up to 2 centimeters. The top of the stem is occupied by the inflorescence, with open flowers and closed buds. The sepals remain fused as the flower blooms from one side. The pink petals are oval in shape and just a few millimeters long. There are 8 stamens, some large and some small and sterile. The fruit is a small, hard body 2 or 3 millimeters long containing 1 or 2 seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Clarkia heterandra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
5,7-dihydroxy-3-[(3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)chromen-4-one	present	LOTUS
Kaempferol 3-rhamnoside	present	LOTUS
Quercetin 3-rutinoside	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clarkia heterandra has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY271538.1 ↗600 bp

ACGT

TCATATCCTGCACAGCAGAACAACCCGAGAACCGGTTAACAACCACTTTGGGAGACTGGGGCACGTCCTCTGCGCTCCCAAATCCCGGCT …

Clarkia heterandra internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Clarkia heterandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-fedorov

CCDB · book-fedorov — Lewis H. et al. 1958

CCDB · book-fedorov — Kurabayashi et al. 1962

CCDB · book-fedorov — Raven 1964

2n 92×CCDB · Cave1958 · CCDB · Cave1962

CCDB · Cave1958 — Lewis et al. 1958

CCDB · Cave1962 — Kurabayashi et al. 1962

n 92×CCDB · Cave1958 · CCDB · Cave1962

CCDB · Cave1958 — Lewis et al. 1958

CCDB · Cave1962 — Kurabayashi et al. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.889 ↗

08Occurrence & distribution

Record type336 records

Wild obs. + sensor106

Museum / vouchered230

Origin

Native2

Range

Area of Occupancy AOO928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 59≤1 km 4≤10 km 6>10 km 9

78 georeferenced · 28 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 5≤1 km 75≤10 km 49>10 km 2

131 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	44
Claremont, US	33
Riverside, US	31
Davis, US	14
San Luis Obispo, US	10
Fredericton Stock Culture Collectionlocation not on record	7
San Diego, US	6
Northridge, US	6
CASlocation not on record	5
Corvallis, US	5
Canadian Department of Agriculturelocation not on record	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
Arcata, US	2
San Jose, US	2
EL PASO, US	2
St. Paul, US	2
Los Angeles, US	2
Columbia, US	1
US	1
Wuzhou, CN	1
Missoula, US	1
Clemson, US	1
KNFYlocation not on record	1
Tempe, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
KNFHClocation not on record	1

26 institutions · 188 of 230 vouchered records shown · 42 without an institution code

09Environmental DNA1 detections

Where the DNA of Clarkia heterandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)