Claoxylon indicum

(Reinw. ex Blume) Hassk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Claoxylon

At a glance

Occurrence records360

Data sources12

Biological traits37

DNA specimens5

eDNA detections4

Sources12 archives

Databases and archives Claoxylon indicum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionDukesPhytochem1 compounds

Occurrence & distributionGBIF360 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 62

01Narrative

Claoxylon indicum is a dioecious flowering plant in the spurge family Euphorbiaceae. The Latin specific epithet indicum means "Indian", referring to the locality of collection of the type specimen, which was probably Java, part of the Dutch East Indies at that time.Flora of Australia Online.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit width8.5 mm

⚠ sources differ — AusTraits: 8.5 mm · GIFT: 7.5 mm

Fruit width max8 mm

Fruit width min7 mm

Leaf length190 mm

⚠ sources differ — AusTraits: 190 mm · GIFT: 160 mm

Leaf length max220 mm

Leaf length min100 mm

Leaf width95 mm

Leaf width max130 mm

Leaf width min60 mm

Petiole length4.5 cm

Plant height6.75 m

⚠ sources differ — GIFT: 6.75 m · AusTraits: 6 m · TRY: 9 m

Plant height max12 m

Plant height min3 m

Seed volume13 mm³

Seed volume max13 mm³

Seed volume min13 mm³

Life cycle & reproduction5

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max400 m

Elevation mean210 m

Elevation min20 m

Epiphyteterrestrial

Fruit fleshinessdry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: tree

Leaf shapeelliptical lanceolate ovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)19.26 mm²/mg

Wood density360 mg/cm³

03Chemical composition1 compounds

Compounds documented for Claoxylon indicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
BETULINIC-ACID		10 ppm	DukesPhytochem

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Claoxylon indicum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences9

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH813146.1 ↗414 bpChina · 2017

ACGT

CTGTGTGAATTGCAGAATCCCGGAACTCGAGTTTGACGCAGTTGCGCCTGAAGCCTTTGGCCGCAACTATAGCCCCCAAATCCTCTACTC …

Claoxylon indicum voucher 1917 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Claoxylon indicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 311×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sinha, A. R. P. & L. R. Mazumdar. 1994. New basic chromosome numbers and cytology of some euphorbiacious plants of Andaman forest (India). Broteria Genet. 15(1–2): 43–48.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type360 records

Wild obs. + sensor113

Museum / vouchered245

Other2

Origin

Native1

Range

Area of Occupancy AOO768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 64≤1 km 17≤10 km 3>10 km 2

86 georeferenced · 27 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 13≤1 km 24≤10 km 25>10 km 2

64 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	47
Beijing, CN	41
Guilin, CN	39
Kunming, CN	11
Kew, GB	7
Kensington, AU	6
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	6
Guangzhou, CN	5
Llocation not on record	3
Brisbane, AU	3
Smithfield, AU	3
Xiamen, CN	2
Kagoshima, JP	2
Ann Arbor, US	2
Changsha, CN	2
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	2
Fujian Institute of Subtropical Botanylocation not on record	2
Mount Annan, AU	1
Cincinnati, US	1
Edinburgh, GB	1
Adelaide, AU	1
Fort Worth, US	1

22 institutions · 188 of 245 vouchered records shown · 56 without an institution code

09Environmental DNA4 detections

Where the DNA of Claoxylon indicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C

Min temp (night)20.7 °C

Precipitation341 mm/mo

Air humidity74.2 %

Moisture balance252 mm/mo

Vapour deficit715 Pa

Wind speed2.10 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)