Cladostemon kirkii

(Oliv.) Pax & Gilg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Cladostemon

At a glance

Occurrence records155

Data sources8

Biological traits17

DNA specimens9

eDNA detections4

Sources8 archives

Databases and archives Cladostemon kirkii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility155 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Occurrence & distributionGBIF155 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Cladostemon kirkii (klados - a branch, stemon - a stamen), commonly known as the three-finger bush, is a small deciduous tree belonging to the Capparaceae or caper family. It is a genus that has only this one species (monotypic). It is distributed through Kenya, Tanzania, Malawi, Mozambique, Zambia, Zimbabwe, Eswatini and KwaZulu-Natal in Southern Africa. The species is named after Sir John Kirk (1832-1922), David Livingstone's companion on his Zambezi expedition of 1858 and the first European collector of the plant near Tete in Mozambique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Plant height4 m

⚠ sources differ — GIFT: 4 m · TRY: 6 m

Plant height max7 m

Plant height min1 m

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Elevation max245 m

Elevation min15 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTdense bushland or coastal thicket

Woodinesswoody

Physiology & chemistry3

Leaf n59.02 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)15.51 mm²/mg

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cladostemon kirkii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences2

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX572409.1 ↗552 bpMozambique · 2010

ACGT

AATGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCA …

Cladostemon kirkii voucher OM2389 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★trnL-F

plant barcode

08Occurrence & distribution

Record type155 records

Wild obs. + sensor57

Museum / vouchered98

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 29≤1 km 9≤10 km 2

40 georeferenced · 17 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	31
Durban, ZA	18
Instituto de Investigação Científica Tropicallocation not on record	10
Saint Louis, US	8
Arusha, TZ	4
TAFORI-LSRClocation not on record	2
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	2
Wlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Stockholm, SE	1
University of Johannesburglocation not on record	1
MeiseBGlocation not on record	1
EAlocation not on record	1
UJlocation not on record	1
M-VascularPlantslocation not on record	1
South Kensington, GB	1

16 institutions · 86 of 98 vouchered records shown · 12 without an institution code

09Environmental DNA4 detections

Where the DNA of Cladostemon kirkii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Mixed miombo Woodland on boulder inselberg

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 22.7–26.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)30.1 °C 25.3–30.6

Min temp (night)21.9 °C 20.0–21.9

Precipitation225 mm/mo 117–243

Air humidity62.8 % 62.1–66.7

Moisture balance71.6 mm/mo

Vapour deficit1,150 Pa 999–1,261

Wind speed1.80 m/s

Cloud cover58.8 % 35.1–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)