Cladosporium sphaerospermum

Penz. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Capnodiales/Cladosporiaceae/Cladosporium

At a glance

Occurrence records1 560

Data sources13

Biological traits0

DNA specimens86

eDNA detections668

Sources13 archives

Databases and archives Cladosporium sphaerospermum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility851 records↗

OBISOcean Biodiversity Information System709 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI668 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics86 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF · OBIS1 560 records

Environmental DNA12 datasets · 30 countries668 detections

DNA & barcodingBOLD · NCBI86 specimens

Genome at a glanceGoaT · NCBI26 Mbp

01Narrative

Cladosporium sphaerospermum is a radiotrophic fungus belonging to the genus Cladosporium and was described in 1886 by Albert Julius Otto Penzig from the decaying leaves and branches of Citrus. It is a dematiaceous (darkly-pigmented) fungus characterized by slow growth and largely asexual reproduction. Cladosporium sphaerospermum consists of a complex of poorly morphologically differentiated, "cryptic" species that share many physiological and ecological attributes. In older literature, all of these sibling species were classified as C. sphaerospermum despite their unique nature. Accordingly, there is confusion in older literature reports on the physiological and habitat regularities of C. sphaerospermum in the strict sense. This fungus is most phylogenetically similar to C. fusiforme. According to modern phylogenetic analyses, the previously synonymized species, Cladosporium langeroni, is a distinct species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition29 compounds

Compounds documented for Cladosporium sphaerospermum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Simple tetramate alkaloids14

3-acyl tetramic acids5

Pyrimidine nucleos(t)ides2

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
3-[(2S)-2-methyl-2,3-dihydropyran-6-ylidene]-5-propan-2-ylidenepyrrolidine-2,4-dione	present	LOTUS
3-[(4-Hydroxyphenyl)methylidene]-5-propan-2-ylidenepyrrolidine-2,4-dione	present	LOTUS
CID 156581823	present	LOTUS
Cladosin A (major tautomer)	present	LOTUS
Cladosin C (major tautomer)	present	LOTUS
Cladosin F	present	LOTUS
Cladosin G	present	LOTUS
Cladosin H	present	LOTUS
Cladosin I	present	LOTUS
Cladosin J	present	LOTUS

05DNA & barcoding86 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cladosporium sphaerospermum has left across the world's sequence archives.

At a glance

DNA specimens86

Marker genes5

GenBank sequences9

eDNA detections668

Countries30

The DNA barcodea real sequence read deposited for this species

ITSPZ359197.1 ↗234 bpIsrael · 2024

ACGT

TGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTC …

Cladosporium sphaerospermum isolate OC.2 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS9★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cladosporium sphaerospermum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size26 130 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Cladosporium sphaerospermum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.3% BUSCO

08Occurrence & distribution

Record type1 560 records

Wild obs. + sensor24

Museum / vouchered1 524

Cultivated / captive12

Range

Area of Occupancy AOO468 km²

Depth

0–200 m sunlit554

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 25 m · 554 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 3≤10 km 21

24 georeferenced

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 5≤1 km 2≤10 km 3>10 km 5

15 georeferenced · 1 509 without coordinates

Open the institutions mapphysical evidence1 524

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 11 without coordinates

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ARMS-MBONlocation not on record	14
Auckland, NZ	9
Uppsala, SE	6
Guasave, MX	4
DPIlocation not on record	3
Sydney Medical Schoollocation not on record	2
Bronx, US	1
National Institute of Biological Resourceslocation not on record	1
CA	1
Pullman, US	1
Tartu, EE	1
Ilvolocation not on record	1
Kew, GB	1
Durango, MX	1
ILLSlocation not on record	1
Madison, US	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1

17 institutions · 49 of 1 524 vouchered records shown · 757 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA668 detections

Where the DNA of Cladosporium sphaerospermum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found668

Studies independent surveys12

Countries30

Verifiable raw sequence linked558

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 668 detections have coordinates

Open the map30 countries0

Marine Protected Area; protected; 9.2 - Subt…Marina; semi-industrial; 9.5 - Subtidal Sand…Birch(Hardwood) dowel buried in soil of a co…Marina; semi-industrial; 9.6 - Subtidal MuddyAfrotropicNeotropicNorth Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 7.70–16.6

Seasonal swing summer↔winter9.40 °C

Max temp (day)13.6 °C 9.10–18.2

Min temp (night)9.90 °C 6.10–14.8

Precipitation94.2 mm/mo 70.9–143

Air humidity64.3 % 62.9–65.2

Vapour deficit507 Pa 368–661

Cloud cover57.1 % 51.7–68.9

CHELSA 1981–2010, ~9 km grid, at location & month of 604 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cladosporium sphaerospermum

At a glance

Sources13 archives

Compound class profile3 classes

Documented compounds29 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 560 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 560 records