Cladophora socialis

Kutz. · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Cladophorales/Cladophoraceae/Cladophora

At a glance

Occurrence records564

Data sources9

Biological traits2

DNA specimens0

eDNA detections35

Sources9 archives

Databases and archives Cladophora socialis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility279 records↗

OBISOcean Biodiversity Information System285 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS3 compounds

Occurrence & distributionGBIF · OBIS564 records

Environmental DNA1 datasets · 1 countries35 detections

DNA & barcodingNCBIsequences

01Narrative

Cladophora socialis is a species of green algae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition3 compounds

Compounds documented for Cladophora socialis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

p-Terphenyls4

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
2,8-Dihydroxy-6-[2-hydroxy-4-(3-hydroxy-4-sulfooxyphenyl)phenoxy]dibenzofuran-3-carboxylic acid	present	LOTUS
6-[4-(3,4-Dihydroxyphenyl)-2-hydroxyphenoxy]-2,8-dihydroxydibenzofuran-3-carboxylic acid	present	LOTUS
XXOTXZKHNZSWSZ-HBDZWIOYSA-N	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cladophora socialis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections35

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK127549.1 ↗1 334 bp

ACGT

TTGGAGGGCAAGTCTGGAGCCAGCCGCGGCAGTAGCTCCAGCTCCAATAGCGTATATGTAAGTTGTTGCGATTAAAAGCCCGTAGCTGAA …

Cladophora socialis voucher G-1240 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type564 records

Wild obs. + sensor99

Museum / vouchered389

Other76

Origin

Native7

Range

Area of Occupancy AOO784 km²

Depth

0–200 m sunlit48

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 0.5 m · max 275 m · 49 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 16≤1 km 21≤10 km 20>10 km 3

60 georeferenced · 39 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 67≤1 km 26≤10 km 29>10 km 2

124 georeferenced · 265 without coordinates

Open the institutions mapphysical evidence389

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	77
BISHlocation not on record	67
Brisbane, AU	21
Bronx, US	10
Wellington, NZ	7
Natick, US	5
Ann Arbor, US	5
MeiseBGlocation not on record	5
University of Stellenboschlocation not on record	3
Durham, US	2
University of Hawaii at Manoalocation not on record	2
Laboratorio de Ictiologialocation not on record	2
Feira de Santana, BR	2
The University and Jepson Herbarialocation not on record	2
Barcelona, ES	1
Tampa, US	1
GRAlocation not on record	1
Chapel Hill, US	1
Institut Francais pour l'Etude de la Merlocation not on record	1
Muséum National d'Histoire Naturellelocation not on record	1
GENTlocation not on record	1

21 institutions · 217 of 389 vouchered records shown · 43 without an institution code

09Environmental DNA35 detections

Where the DNA of Cladophora socialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature29.1 °C 27.3–30.9

Salinity35.4 PSU

Depth2.00 m

SedimentCoastal water

29 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 20.9–27.4

Seasonal swing summer↔winter7.30 °C

Max temp (day)27.2 °C 23.5–29.1

Min temp (night)24.2 °C 18.2–25.2

Precipitation120 mm/mo 26.0–344

Air humidity59.8 % 57.7–62.0

Vapour deficit1,303 Pa 1,056–1,399

Cloud cover40.8 % 29.2–59.0

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)