Cladius pectinicornis

(Geoffroy, 1785) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Cladius

At a glance

Occurrence records2 656

Data sources9

Biological traits0

DNA specimens205

eDNA detections356

Sources9 archives

Databases and archives Cladius pectinicornis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 656 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI356 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics205 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 656 records

Environmental DNA4 datasets · 20 countries356 detections

DNA & barcodingBOLD205 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Cladius difformis, the bristly rose slug, is a species of common sawfly in the family Tenthredinidae. They go through several generations a year. Can cause damage to roses, raspberries and strawberries. Native to the Palaearctic, probably accidentally introduced in the Nearctic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding205 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cladius pectinicornis has left across the world's sequence archives.

At a glance

DNA specimens205

BINs8

Marker genes1

eDNA detections356

Countries22

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus188 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 132 variable positions, in barcode order

1Cmostly conserved

2Amostly conserved

4Tmostly conserved

5Avariable

7Amostly conserved

8Cmostly conserved

9Tmostly conserved

11Cmostly conserved

12Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Gmostly conserved

19Gmostly conserved

20Amostly conserved

22Tmostly conserved

23Tmostly conserved

25Gmostly conserved

27Tmostly conserved

28Cmostly conserved

29Gvariable

30Gmostly conserved

31Gmostly conserved

33Amostly conserved

36Tmostly conserved

37Tmostly conserved

39Gmostly conserved

40Gmostly conserved

41Amostly conserved

42Cmostly conserved

43Tmostly conserved

44Tvariable

46Cmostly conserved

47Amostly conserved

48Tmostly conserved

49Tmostly conserved

50Tmostly conserved

52Gmostly conserved

54Amostly conserved

57Cmostly conserved

59Amostly conserved

60Amostly conserved

61Tmostly conserved

62Tmostly conserved

63Cmostly conserved

64Gmostly conserved

66Amostly conserved

67Cmostly conserved

69Gmostly conserved

70Amostly conserved

72Cmostly conserved

73Tmostly conserved

75Gmostly conserved

76Gmostly conserved

78Amostly conserved

79Tmostly conserved

81Cmostly conserved

82Cmostly conserved

84Gmostly conserved

85Gmostly conserved

88Cmostly conserved

89Amostly conserved

90Tmostly conserved

92Amostly conserved

93Amostly conserved

94Tmostly conserved

95Tmostly conserved

97Gmostly conserved

98Amostly conserved

104Cvariable

125Cmostly conserved

128Cvariable

131Tmostly conserved

134Tmostly conserved

141Cmostly conserved

152Tmostly conserved

167Amostly conserved

179Amostly conserved

191Tmostly conserved

195Tmostly conserved

200Amostly conserved

210Cmostly conserved

212Amostly conserved

221Tmostly conserved

236Cvariable

248Tmostly conserved

272Cmostly conserved

276Tmostly conserved

284Tmostly conserved

285Cmostly conserved

287Tmostly conserved

288Tmostly conserved

290Amostly conserved

314Amostly conserved

317Amostly conserved

350Tmostly conserved

352Avariable

353Tmostly conserved

362Tmostly conserved

371Gvariable

377Amostly conserved

380Tmostly conserved

389Tmostly conserved

395Tmostly conserved

398Cmostly conserved

425Cmostly conserved

431Cvariable

437Cmostly conserved

443Tmostly conserved

452Tmostly conserved

491Tmostly conserved

497Cmostly conserved

506Amostly conserved

527Tmostly conserved

528Cmostly conserved

536Tmostly conserved

539Amostly conserved

540Tmostly conserved

542Amostly conserved

545Amostly conserved

+12 more variable positions not shown

CATTATACTTCATTTTTGGATTTTGATCGGGAATATTAGGACTTTCATTTAGAATACTAATTCGAACAGAACTAGGAATACCAGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes23

BINs8

Most divergent pair12.5%

EuropeAsiaAfricaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euura lipovskyisame family11.3%Rhogogaster chlorosomasame family11.7%Rhogogaster scalarissame family11.7%Rhogogaster viridissame family11.7%Euura jugicolasame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Cladius pectinicornis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records6–122n range12median12mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 61×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type2 656 records

Wild obs. + sensor1 563

Museum / vouchered1 093

Range

Area of Occupancy AOO6 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 643≤1 km 200≤10 km 259>10 km 77

1 179 georeferenced · 384 without coordinates

Open the mapobservation + sensor1 563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 340≤1 km 128≤10 km 179>10 km 2

649 georeferenced · 444 without coordinates

Open the institutions mapphysical evidence1 093

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	245
MZLUlocation not on record	121
BioFokuslocation not on record	118
Oulu, FI	109
Institute of Zoology Slovak Academy of Scienceslocation not on record	61
Stockholm, SE	45
ZMAAlocation not on record	33
Sanda, JP	29
NCMGlocation not on record	26
Tilburg, NL	20
SLU Artdatabankenlocation not on record	18
neflocation not on record	15
ZSMlocation not on record	14
Bonn, DE	12
Tromsø, NO	12
Helsinki, FI	11
Philadelphia, US	10
Tartu, EE	9
DFlocation not on record	6
Bavarian State Collection of Zoologylocation not on record	6
Natural History Museum Rotterdamlocation not on record	5
University of Oululocation not on record	5
South Kensington, GB	5
Chicago, US	5
Gothenburg, SE	4
NEFlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Edmonton, CA	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
KCMNlocation not on record	1
University of Oulu, Zoological Museumlocation not on record	1
UGRlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
IMEDEAlocation not on record	1
Chiba, JP	1
Champaign, US	1

36 institutions · 959 of 1 093 vouchered records shown · 134 without an institution code

09Environmental DNA356 detections

Where the DNA of Cladius pectinicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found356

Studies independent surveys4

Countries20

Verifiable raw sequence linked181

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 356 detections have coordinates

Open the map20 countries0

UrbanFen edgeBog edge in alpine birch forest1.1. Boreal Forest|1. Forest & Woodland14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 8.40–17.2

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.2 °C 9.70–21.2

Min temp (night)10.9 °C 5.40–13.8

Precipitation67.9 mm/mo 38.0–103

Air humidity60.0 % 57.2–62.9

Moisture balance-42.9 mm/mo -71.8–7.00

Vapour deficit678 Pa 438–798

Wind speed3.10 m/s 2.30–5.30

Cloud cover43.6 % 37.4–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 355 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cladius pectinicornis

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 656 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 656 records