Citrus swinglei

Burkill ex Harms · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records39

Data sources6

Biological traits5

DNA specimens6

eDNA detections4

Sources6 archives

Databases and archives Citrus swinglei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Citrus swinglei, le kumquat malais, est une espèce de kumquat ; un type d'agrume du genre Citrus, famille des Rutacées. Il est décrit pour la première fois par Burkill et Harms en 1931. Citrus swinglei, de la péninsule Malaise où il est connu sous le nom de « tilleul de haie », possède des chromosomes de type E. Il a une fine peau sur les fruits plus gros que tous les autres kumquats.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formshrub

Woodinesswoody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus swinglei has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ434160.1 ↗681 bp

ACGT

CGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACCAGTTCATATCACCGGCGGCGGGAGGGGGT …

Fortunella polyandra internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type39 records

Museum / vouchered39

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 39 records without

Open the institutions mapphysical evidence39

10Collections & institutions

Institution	Specimens
UFMSlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1

2 institutions · 2 of 39 vouchered records shown · 37 without an institution code

09Environmental DNA4 detections

Where the DNA of Citrus swinglei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)21.6 °C

Min temp (night)12.2 °C

Precipitation178 mm/mo

Air humidity65.7 %

Moisture balance78.2 mm/mo

Vapour deficit677 Pa

Wind speed1.80 m/s

Cloud cover43.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)