Citrus microcarpa

Bunge · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records145

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Citrus microcarpa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

NCBIUS National Library of Medicinesequences↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF145 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Le calamondin, calamansi, lime des Philippines, citron des Philippines ou oranger d'appartement est un agrume apprécié pour sa floraison remontante et parfumée, par son abondante fructification toute l'année, faite de petits fruits colorés qui restent longtemps sur l'arbre. Les fruits sont comestibles, juteux et aromatiques, la peau est sucrée, la pulpe acide. Il est largement utilisé dans la cuisine des Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus microcarpa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMH069765.1 ↗605 bpMalaysia · 2014

ACGT

TATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCA …

Citrus x microcarpa voucher A2378 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Citrus microcarpa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type145 records

Wild obs. + sensor51

Museum / vouchered90

Cultivated / captive4

Origin

Introduced18

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 35≤1 km 5≤10 km 2>10 km 2

44 georeferenced · 7 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 6≤10 km 1

7 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence90

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	6
Taipei, TW	5
Guangzhou, CN	2
Kensington, AU	2
Brisbane, AU	2
Shanghai, CN	2
National Biodiversity Institute, Costa Ricalocation not on record	2
Canberra, AU	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Tampa, US	1
Seoul, KR	1
TAIElocation not on record	1

12 institutions · 27 of 90 vouchered records shown · 63 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)