Citrus latipes

(Swingle) Yu.Tanaka · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records8

Data sources9

Biological traits9

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Citrus latipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS18 compounds

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Citrus latipes, kashi papeda est un agrume endémique du plateau de Shillong, des montagnes de Khasi au Meghalaya, de l'Assam et du Nagaland en Inde et dans les montagnes de Birmanie. La plante n'est pas cultivée. Elle est souvent donnée comme synonyme du combava. Elle est remarquablement adaptée à l'altitude jusqu'à 1 800 m et est utilisée par les populations locales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max2 100 m

Elevation min1 900 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

03Chemical composition18 compounds

Compounds documented for Citrus latipes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavanones11

Limonoids7

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-5-hydroxy-2-(3-hydroxy-4-methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-7-[(2S,3S,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
7-[4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(3-hydroxy-4-methoxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
Deacetylnomilin	present	LOTUS
Didymin	present	LOTUS
Eriocitrin	present	LOTUS
Hesperidin	present	LOTUS
Ichangin	present	LOTUS
Limonin glucoside	present	LOTUS
Linonin	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus latipes has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences8

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGQ225851.1 ↗582 bpIndia

ACGT

CTGCCCAGCAGAACGACCCGCGAACCAGTTGATATCACCGGCGGCGGGAGGGGGGACGCGTCCGCAGCGGGCGCTCCTCCTTTCCCGCCC …

Citrus latipes isolate CLAT-N4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type8 records

Museum / vouchered6

Other2

Origin

Native2

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

10Collections & institutions

Institution	Specimens
CNF-UFHBlocation not on record	2
Herbarium of the Department of Botany, University of Tokyolocation not on record	1

2 institutions · 3 of 6 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Citrus latipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)