Citrus latifolia

(Yu.Tanaka ex Yu.Tanaka) Yu.Tanaka · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records89

Data sources7

Biological traits0

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Citrus latifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionFooDB5 579 compounds

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Citrus × latifolia est un hybride de la famille des Rutaceae. Cet arbre fruitier est appelé Limettier de Perse ou Limettier de Tahiti. Son fruit est la lime de Perse ou lime de Tahiti, couramment appelée citron vert et parfois lime gros-fruit. Il s'agit d'une espèce différente de C. aurantiifolia, le Limettier du Mexique, qui produit la lime acide ou lime petit-fruit. Le Limettier de Tahiti est naturellement triploïde et le fruit est sans pépin. C'est l'un des deux seuls cas de polyploïdie naturelle chez les limes, avec une lime tétraploïde naturelle, semis d'une lime mexicaine obtenue en 1973 par HC Barrett.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition5 579 compounds

Compounds documented for Citrus latifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingFruits

Compound class profile5 classes

Aminoacids69

Glycerophospholipids57

Cinnamic acids and derivatives30

Purine nucleos(t)ides26

Monosaccharides25

Documented compounds5 579 total

Tissue Source Quantified only

Compound	Amount	Source
Sugars	1,690 mg/100g	FooDB
D-Fructose	610 mg/100g	FooDB
D-Mannose	600 mg/100g	FooDB
Sucrose	480 mg/100g	FooDB
Potassium	117 mg/100g	FooDB
L-Aspartic acid	114 mg/100g	FooDB
L-Glutamic acid	67 mg/100g	FooDB

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus latifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY963147.1 ↗324 bpIran

ACGT

TCGTGACTCGAGTCTTTGACGCAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCA …

Citrus x latifolia isolate IFJK 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7

plant barcodefungal barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor41

Museum / vouchered42

Cultivated / captive2

Other4

Origin

Introduced19

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 21≤1 km 5≤10 km 1>10 km 4

31 georeferenced · 10 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence42

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	16
Istituto Agrario Castelnuovolocation not on record	3
San José, CR	3
Ilhéus, BR	2
Saint Louis, US	2
Jataí / Setor Industrial, BR	2
Brasília, BR	1
UEMlocation not on record	1
UNISANTAlocation not on record	1
Institut fur Allgemeine Mikrobiologielocation not on record	1
Instituto Nacional de Biodiversidadlocation not on record	1
Laboratorio de Ictiologialocation not on record	1
Brasília, BR	1
Cenargenlocation not on record	1
UNICAMPlocation not on record	1
Austin, US	1
Canberra, AU	1
UNEMATlocation not on record	1
UNESP-RClocation not on record	1

19 institutions · 41 of 42 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Citrus latifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Citrus latifolia

At a glance

Sources7 archives

Compound class profile5 classes

Documented compounds5 579 total

At a glance

Record type89 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Documented compounds5 579 total