Citrus junos

Siebold ex Yu.Tanaka · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records144

Data sources11

Biological traits11

DNA specimens11

eDNA detections11

Sources11 archives

Databases and archives Citrus junos's data was compiled from.

WikipediaWikimedia Foundation18 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources11 traits

Chemical compositionLOTUS · NPASS102 compounds

Occurrence & distributionGBIF144 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Yuzu (Citrus junos, from Japanese or ) is a citrus fruit and plant in the family Rutaceae of East Asian origin. Yuzu has been cultivated mainly in East Asia, though recently also in New Zealand, Australia, Spain, Italy, and France.Japan External Trade Organization (日本貿易振興機構 JETRO ジェトロ) . It is believed to have originated in central China as an F1 hybrid of the mangshanyeju subspecies of mandarin orange and the ichang papeda.and Supplement The yuzu is called yuja (from Korean ) in Korean cuisine. Both Japanese yuzu and Korean yuja are borrowings of the kanji/hanja yòuzi (), though this Chinese word now refers to the pomelo due to semantic shift.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Size & morphology4

Plant height5 m

Seed volume860 mm³

Seed volume max860 mm³

Seed volume min860 mm³

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment4

Climberself-supporting

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition102 compounds

Compounds documented for Citrus junos across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acyclic monoterpenoids23

Flavanones13

Simple coumarins9

Limonoids7

Monocyclic monoterpenoids7

Documented compounds102 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Abscisic acid beta-D-glucopyranosyl ester	present	NPASS
(+)-alpha-Pinene	present	LOTUS
(+)-beta-Phellandrene	present	NPASS
(+)-Linalyl acetate	present	NPASS
(+)-Marmin	present	LOTUS
(+)-Sabinene	present	NPASS
(-)-beta-Pinene	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(-)-Isocaryophyllene	present	LOTUS
(1R)-4-methyl-1-prop-1-en-2-ylcyclohex-3-en-1-ol	present	NPASS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus junos has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences10

eDNA detections11

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG702198.1 ↗663 bp

ACGT

GAAGGATCATTGTCGACCTGCCAGCAGACGACCCGCGAACCAGTTGATATCACCGGCGGCGGGAGGGGGTGCGCGTCCGCAACGGGCGCT …

Citrus junos cultivar Yuzu internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Citrus junos carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liang, G. l. 1990. Studies on the cytotaxonomy of Citrus. I. Karyotype and evolution of thirty taxa of the genus Citrus. J. Wuhan Bot. Res. 8: 1–7.

CCDB · ipcn-api-dl — Liang, G. l. & Q. y. Chen. 1994. Studies on the system and evolution of satellite chromosomes in Citrus. J. SouthW. Agric. Univ. 16(2): 106–110.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type144 records

Wild obs. + sensor19

Museum / vouchered121

Other4

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 1>10 km 2

4 georeferenced · 15 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nanjing, CN	44
Guangzhou, CN	9
Beijing, CN	9
Kunming, CN	8
Kochi, JP	5
Tsukuba, JP	5
Odawara, JP	4
Guiyang, CN	3
Sanda, JP	3
Zhejiang Universitylocation not on record	2
Herbarium of the Department of Botany, University of Tokyolocation not on record	2
Tokushima, JP	2
Wuhan, CN	2
Chiba, JP	2
黔东南州民族医药研究所标本室location not on record	2
Sagamihara, JP	1
Anhui Normal Universitylocation not on record	1
JMSlocation not on record	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Chengdu, CN	1
HUFDlocation not on record	1
Nagano City, JP	1
KURAlocation not on record	1
UTPLlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
WNNUlocation not on record	1
Sendai, JP	1
Bando, JP	1
Central China Normal Universitylocation not on record	1

29 institutions · 116 of 121 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Citrus junos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)