Citrus garrawayi

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records143

Data sources10

Biological traits19

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Citrus garrawayi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF143 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈317 Mbp

01Narrative

Citrus garrawayi, the Mount White lime, is a tree native to the Cape York region of northern Queensland in Australia. It is an understory tree in tropical rainforests.Frederick Manson Bailey. 1900. Queensland Agricultural Journal 15:491, Citrus garrawayi Citrus garrawayi is a shrub or small tree up to , with broad lanceolate leaves. Fruits are elongated, yellowish-green with green pulp. The fruits are edible but the species is rare and grows in an isolated location, so there has to date been no commercial use of it.Citrus pages, Native Australian Citrus, Citrus garrawayae The species is often included in the genus Microcitrus rather than in the genus Citrus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRY

Size & morphology9

Fruit length100 mm

Fruit width20 mm

Leaf length37.5 mm

Leaf width17.5 mm

Petiole length0.3 cm

Plant height12 m

Seed length7 mm

Seed mass22.89 mg

Seed width4.5 mm

Life cycle & reproduction4

Deciduousnessevergreen

Flowering timennnnyyyyyyyn

Life spanperennial

Sex typehermaphrodite

Habitat & environment6

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — AusTraits: tree · TRY: shrub/tree

Leaf compoundnesssimple

Leaf shapenarrowly_ovate rhomboidal

Woodinesswoody

03Chemical composition13 compounds

Compounds documented for Citrus garrawayi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furocoumarins $ Simple coumarins7

Furocoumarins3

Lanostane, Tirucallane and Euphane triterpenoids1

Acyclic monoterpenoids1

Flavones1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-2-(2-hydroxypropan-2-yl)-9-(3-methylbut-2-enoxy)-2,3-dihydrofuro[3,2-g]chromen-7-one	present	LOTUS
2-[(2S)-9-hydroxy-7-oxo-2,3-dihydrofuro[3,2-g]chromen-2-yl]propan-2-yl acetate	present	LOTUS
8-Geranyloxypsoralen	present	LOTUS
9-[(E,6S)-6,7-dihydroxy-3,7-dimethyloct-2-enoxy]furo[3,2-g]chromen-7-one	present	LOTUS
9-Hydroxy-2-(2-hydroxypropan-2-yl)furo[3,2-g]chromen-7-one	present	LOTUS
Apigenin	present	LOTUS
Bourjotinolone A	present	LOTUS
Linalool oxide pyranoid, (+-)-	present	LOTUS
Xanthotoxol	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus garrawayi has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ434163.1 ↗700 bp

ACGT

AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACCAGTTGATATTACTGGCGGTGGG …

Microcitrus garrowayae internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Citrus garrawayi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈316 851 361 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Citrus garrawayi0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type143 records

Wild obs. + sensor2

Museum / vouchered116

Other25

Origin

Native3

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 19≤1 km 54≤10 km 28>10 km 5

106 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	58
Brisbane, AU	38
Canberra, AU	7
Museo Entomologico de Leonlocation not on record	3
Mount Annan, AU	2
Palmerston, AU	2
James Cook Townsvillelocation not on record	1

7 institutions · 111 of 116 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Citrus garrawayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)