Citrus assamensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Citrus

At a glance

Occurrence records3

Data sources6

Biological traits5

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Citrus assamensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF3 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Citrus assamensis est un agrume sauvage du nord-est de l'Inde marginalement cultivé pour son utilisation en cuisine et en voie de disparition, son aire de répartition naturelle va de l'Assam au Bangladesh.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citrus assamensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM017439.1 ↗1 456 bpIndia

ACGT

GGGCGACTTTTTATTAAGGGAAGCTATTAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCA …

UNVERIFIED: Citrus assamensis voucher IC 285355 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit-like (rbcL) gene, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Citrus assamensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-indian_vol1 · CCDB · iapt · CCDB · Cave1962

CCDB · book-indian_vol1 — Naithani, S.P. & Raghuvanshi, S.S. 1958 ; Raghuvanshi, S.S. 1962a, b

CCDB · iapt — IAPT/IOPB Chromosome Data 17

CCDB · Cave1962 — Raghuvanshi 1962.b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 records

Museum / vouchered1

Other2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1