Citronella smythii

(F.Muell.) R.A.Howard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cardiopteridales/Cardiopteridaceae/Citronella

At a glance

Occurrence records351

Data sources7

Biological traits33

DNA specimens10

eDNA detections5

Sources7 archives

Databases and archives Citronella smythii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility351 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF351 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Citronella smythii là một loài thực vật có hoa trong họ Cardiopteridaceae. Loài này được (F.Muell.) R.A.Howard mô tả khoa học đầu tiên năm 1940.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length14 mm

⚠ sources differ — AusTraits: 14 mm · GIFT: 18.5 mm

Fruit width10.5 mm

⚠ sources differ — AusTraits: 10.5 mm · GIFT: 13 mm

Leaf length170 mm

Leaf mass362 mg

Leaf mass per area65.22 g/m2

Leaf size5 508 mm²

Leaf width85 mm

Petiole length1.1 cm

Plant height25 m

⚠ sources differ — AusTraits: 25 m · TRY: 5.62 m

Seed length12 mm

Seed mass310 mg

Seed mass max310 mg

Seed mass min310 mg

Seed width11 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennnnnnyynnnn

Life formtree

Life spanperennial

Pollination syndromebee

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: shrub/tree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate ovate

Woodinesswoody

Physiology & chemistry1

Wood density567 mg/cm³

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citronella smythii has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences1

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496665.1 ↗552 bpAustralia · 2013

ACGT

AGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Citronella smythii isolate BATT445-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type351 records

Wild obs. + sensor18

Museum / vouchered267

Other66

Origin

Native8

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 17 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 25≤1 km 24≤10 km 96>10 km 30

175 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	96
Brisbane, AU	68
Museo Entomologico de Leonlocation not on record	22
Canberra, AU	19
Mount Annan, AU	8
James Cook Townsvillelocation not on record	6
Zürich, CH	5
Saint Louis, US	5
Kew, GB	4
Palmerston, AU	4
Australian Tropical Herbariumlocation not on record	2
Parkville, AU	1
Hobart, AU	1
CSIRO, Tropical Forest Research Centrelocation not on record	1
Adelaide, AU	1
University of the Sunshine Coastlocation not on record	1
Burlington, US	1
Honolulu, US	1
ASUlocation not on record	1
Armidale, AU	1

20 institutions · 248 of 267 vouchered records shown · 18 without an institution code

09Environmental DNA5 detections

Where the DNA of Citronella smythii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 15.4–26.0

Seasonal swing summer↔winter7.80 °C

Max temp (day)27.8 °C 19.9–28.3

Min temp (night)15.0 °C 11.2–23.9

Precipitation52.7 mm/mo 24.1–213

Air humidity63.9 % 50.1–65.4

Moisture balance-47.1 mm/mo

Vapour deficit1,077 Pa 659–1,466

Wind speed3.40 m/s

Cloud cover31.6 % 22.5–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)