Citronella mucronata

(Ruiz & Pav.) D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cardiopteridales/Cardiopteridaceae/Citronella

At a glance

Occurrence records4 537

Data sources6

Biological traits16

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Citronella mucronata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 537 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF4 537 records

DNA & barcodingNCBIsequences

01Narrative

Citronella mucronata est une espèce d'arbres à feuilles persistantes de la famille des Cardiopteridaceae endémique au Chili. Il est dénommé huillipatagua, ou naranjillo, ou citronnelle chilienne. Il pousse dans la région du matorral chilien au centre du Chili.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height14 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max700 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTÁrea Antrópica, Floresta Ombrófila Mista

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citronella mucronata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ429997.1 ↗725 bpChile

ACGT

CAAGGTTTCGGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCTCGAAAAGAAGATATGTGAACCCTGTAAAAACAAAAAGAAGGGGTT …

Citronella mucronata voucher Arboretum Antumapu 2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type4 537 records

Wild obs. + sensor4 307

Museum / vouchered230

Range

Area of Occupancy AOO2 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 4 025≤1 km 104≤10 km 29>10 km 19

4 177 georeferenced · 130 without coordinates

Open the mapobservation + sensor4 307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 143

143 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LEPUDEClocation not on record	143
Edinburgh, GB	22
Valparaiso, CL	20
UChlocation not on record	8
Chicago, US	4
Kew, GB	3
Herbario Universidad de Concepciónlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Campo Mourão, BR	1
Uberlândia, BR	1
Valparaíso, CL	1
Ann Arbor, US	1
MAlocation not on record	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Santiago, CL	1
PLAlocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1
UTFPR-CPlocation not on record	1

19 institutions · 215 of 230 vouchered records shown · 15 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Citronella mucronata

At a glance

Sources6 archives

Size & morphology1

Life cycle & reproduction4

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

At a glance

Record type4 537 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Record type4 537 records