Citronella moorei

(F.Muell. ex Benth.) R.A.Howard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cardiopteridales/Cardiopteridaceae/Citronella

At a glance

Occurrence records1 013

Data sources6

Biological traits41

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Citronella moorei's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 013 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF1 013 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length20 mm

Fruit width20 mm

Leaf length100 mm

Leaf length max150 mm

Leaf length min60 mm

Leaf mass per area62.61 g/m2

Leaf size3 504 mm²

Leaf width50 mm

Leaf width max70 mm

Leaf width min30 mm

Petiole length1 cm

Plant height40 m

Plant height max40 m

Seed length18 mm

Seed width14 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering endSep

Flowering startMay

Flowering timennnnyyyyynnn

Life formtree

Life spanperennial

Pollination syndromebee

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)15.68 mm²/mg

Wood density582 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citronella moorei has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896008.1 ↗500 bpAustralia

ACGT

AAGTGCTGGATTCAAAGGTGGTGTTAAAGATTACAAATCGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Citronella moorei voucher 1076418255 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type1 013 records

Wild obs. + sensor753

Museum / vouchered213

Cultivated / captive2

Other45

Origin

Native36

Range

Area of Occupancy AOO2 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 664≤1 km 22≤10 km 40>10 km 1

727 georeferenced · 26 without coordinates

Open the mapobservation + sensor753

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 21≤1 km 22≤10 km 94>10 km 19

156 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence213

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	54
Smithfield, AU	40
Mount Annan, AU	36
Canberra, AU	21
Museo Entomologico de Leonlocation not on record	19
Armidale, AU	14
Kew, GB	5
Wollongong, AU	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Saint Louis, US	2
Palmerston, AU	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Honolulu, US	1
Uppsala, SE	1
Batemans Bay, AU	1

16 institutions · 204 of 213 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Citronella moorei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter11.0 °C

Max temp (day)21.6 °C

Min temp (night)12.0 °C

Precipitation130 mm/mo

Air humidity61.8 %

Moisture balance16.5 mm/mo

Vapour deficit718 Pa

Wind speed3.00 m/s

Cloud cover24.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Citronella moorei

At a glance

Sources6 archives

Size & morphology15

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type1 013 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 013 records