Citharexylum spinosum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Verbenaceae/Citharexylum

At a glance

Occurrence records1 827

Data sources13

Biological traits96

DNA specimens10

eDNA detections8

Sources13 archives

Databases and archives Citharexylum spinosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 827 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources96 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF1 827 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 60

01Narrative

De hertenrits is een sierlijke heester of kleine boom met geurige bloesem. De boom kan altijdgroen of bladverliezend zijn, afhankelijk van het plaatselijk klimaat. De stam kan 30 cm in doorsnee worden en tot 18 meter hoog, hoewel de boom op vele plaatsen kleiner blijft. Het verspreidingsgebied ligt in tropisch en subtropisch Amerika: de Guyana's, Venezuela, Panama, de Caribische eilanden, Trinidad, Cuba, de Bahama's en Zuid-Florida. In Suriname is de boom vooral bekend van de ritsen van het kustgebied. Vandaar dat hij naar de Hertenrits vernoemd is. De boom wordt in het wild gekapt voor zijn hout. Hij krijgt prachtige trossen met witte bloemen die bij de bijen in trek zijn vanwege hun nectar. De vrucht is eetbaar en zoetig maar wordt door mensen niet veel gegeten.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYAusTraitsGIFTUSDA

Size & morphology6

Leaf size6 662 mm²

Plant height14.3 m

⚠ sources differ — GIFT: 14.3 m · USDA: 7.62 m · TRY: 10.52 m

Plant height max30 m

Seed mass136 mg

Seed mass max136 mg

Seed mass min136 mg

Life cycle & reproduction25

Bloom periodSummer

Coppice potentialNo

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Dispersal typeanimal

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSpring

Growth rate USDASlow

Life spanperennial

Lifespan categoryShort

Pollination modebiotic

Pollination syndromeinsect

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formphanerophyte

Resprout abilityNo

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment26

Active growth periodYear Round

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterDense

Foliage textureMedium

Fruit colouryellow

Growth formtree

Growth form USDASingle Stem

Habitat GIFTFloresta de Terra Firme, Floresta de Várzea

Hedge toleranceLow

Known allelopathNo

Leaf retentionYes

Low growing grassNo

Root depth min24 in

Shape and orientationOval

Small grainNo

Woodinesswoody

Physiology & chemistry20

C:N ratioHigh

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Frost free days min365 days

Leaf c487 mg/g

Leaf n18.21 mg/g

Leaf p0.689 mg/g

Nitrogen fixation levelNone

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Salinity toleranceMedium

Shade toleranceMedium

Soil pH max8 pH

Soil pH min5 pH

Specific leaf area (SLA)18.43 mm²/mg

Temperature min40 °F

Wood density604 mg/cm³

Uses & economy12

Berry nut seed productNo

Christmas tree productNo

Fodder productNo

Fuelwood productLow

Lumber productYes

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productYes

Pulpwood productNo

Seeds per pound45 635 per lb

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr11.58 m

Planting density max1 280 per acre

Planting density min320 per acre

03Chemical composition7 compounds

Compounds documented for Citharexylum spinosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iridoids monoterpenoids6

Flavones1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
5-Deoxypulchelloside I	present	LOTUS
5-hydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-methoxy-6-[(2S,3R,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
Lamiide	present	LOTUS
Lamiidoside	present	LOTUS
methyl (1R,4aS,6R,7S,7aR)-4a,7-dihydroxy-6-[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxy-7-methyl-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
methyl (1S,4aR,6S,7R,7aS)-4a,7-dihydroxy-6-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]oxy-7-methyl-1-[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
Phlomiol	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citharexylum spinosum has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences7

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAY178655.1 ↗628 bp

ACGT

TCGGACCTACAAGCAGGCCGCGAACAGTGTTTCAGGGCAAACTTCGGGTGCCTCGGCGTGGGGGGAAGCCTCCCGTCGCGGCCCCTTCCC …

Citharexylum spinosum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Citharexylum spinosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 601×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mitra, S. 1968

n 381×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Nehra 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 827 records

Wild obs. + sensor1 285

Museum / vouchered542

Origin

Introduced167

Range

Area of Occupancy AOO4 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 796≤1 km 147≤10 km 64>10 km 60

1 067 georeferenced · 218 without coordinates

Open the mapobservation + sensor1 285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 17≤1 km 18≤10 km 20>10 km 2

57 georeferenced · 485 without coordinates

Open the institutions mapphysical evidence542

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions34 of 52 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	159
St. Augustine, TT	43
Tampa, US	26
University of Stellenboschlocation not on record	22
Mount Annan, AU	10
Saint Louis, US	9
UEPAlocation not on record	7
Wlocation not on record	7
Brisbane, AU	6
Fredericksburg, US	4
Montréal, CA	4
NHMJlocation not on record	4
Honolulu, US	4
Miami, US	3
WTUlocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Berlin, DE	3
Chicago, US	3
BISHlocation not on record	3
Toronto, CA	3
Bloomington, US	3
MeiseBGlocation not on record	3
Fort Worth, US	3
Durban, ZA	2
Dekalb, US	2
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
Smithfield, AU	2
Stockholm, SE	2
Pondicherry, IN	2
Canadian Department of Agriculturelocation not on record	1
Moscow, US	1
Chongqing Museumlocation not on record	1
HAWlocation not on record	1
Auckland, NZ	1
Adelaide, AU	1
Vancouver, CA	1
Qarshi Botanical Gardenlocation not on record	1
Kensington, AU	1
Altos de Pipe, VE	1
Xiamen, CN	1
Gujarat Biodiversity Gene Banklocation not on record	1
Alexandria Universitylocation not on record	1
Phoenix, US	1
Gump Stationlocation not on record	1
Pretoria, ZA	1
Palmerston, AU	1
UNESP-FCAlocation not on record	1
Paris, FR	1
EL PASO, US	1
ASUlocation not on record	1
Angwin, US	1

52 institutions · 371 of 542 vouchered records shown · 167 without an institution code

09Environmental DNA8 detections

Where the DNA of Citharexylum spinosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 23.1–25.7

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.7 °C 27.3–29.6

Min temp (night)21.5 °C 17.7–23.2

Precipitation144 mm/mo 0.5–183

Air humidity66.4 % 53.9–66.7

Moisture balance-11.0 mm/mo

Vapour deficit1,105 Pa 998–1,334

Wind speed2.50 m/s

Cloud cover25.5 % 10.5–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Citharexylum spinosum

At a glance

Sources13 archives

Size & morphology6

Life cycle & reproduction25

Diet & foraging1

Habitat & environment26

Physiology & chemistry20

Uses & economy12

Other traits6

Compound class profile2 classes

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 827 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions34 of 52 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 827 records