Citharexylum montevidense

(Spreng.) Moldenke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Verbenaceae/Citharexylum

At a glance

Occurrence records445

Data sources8

Biological traits17

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Citharexylum montevidense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility445 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF445 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Citharexylum montevidense là một loài thực vật có hoa trong họ Cỏ roi ngựa. Loài này được (Spreng.) Moldenke mô tả khoa học đầu tiên năm 1933.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height7.5 m

Plant height max4 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTCampo de Altitude, Campo Limpo, Floresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Citharexylum montevidense has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLHM853911.1 ↗521 bp

ACGT

AAAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCCTTACGTCTGTCTGGTGGGGATCATATTCACGCTGGTACCGTAGTAGGTAAA …

Citharexylum montevidense ribulose-1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★trnL-F★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type445 records

Wild obs. + sensor328

Museum / vouchered117

Origin

Native21

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 145≤1 km 59≤10 km 30>10 km 7

241 georeferenced · 87 without coordinates

Open the mapobservation + sensor328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 3≤10 km 3>10 km 3

9 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Isidro, AR	23
Corrientes, AR	21
Bronx, US	14
San Jose State University, Museum of Birds and Mammalslocation not on record	11
Saint Louis, US	5
UNESClocation not on record	3
Castelar, AR	3
University of Stellenboschlocation not on record	2
MVJBlocation not on record	2
ASUlocation not on record	2
PUC-RSlocation not on record	2
Lake Charles, US	2
Blumenau, BR	2
Stockholm, SE	2
UFSMlocation not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
Criciúma, BR	1
Feira de Santana, BR	1
Paris, FR	1
Paleontological Collectionlocation not on record	1
Northridge, US	1
IAPlocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1
FUVATESlocation not on record	1
Santa Maria, BR	1
Entomological Society of Latvialocation not on record	1
Laboratorio de Ictiologialocation not on record	1
Tampa, US	1
Museo y Jardín Botánico - Intendencia de Montevideolocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
South Kensington, GB	1
WTUlocation not on record	1
UTFPR-CPlocation not on record	1
UFSClocation not on record	1
Museo y Jardin Botanico Prof. Atilio Lombardolocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1

36 institutions · 116 of 117 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Citharexylum montevidense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter11.5 °C

Max temp (day)18.9 °C

Min temp (night)14.5 °C

Precipitation89.2 mm/mo

Air humidity61.7 %

Moisture balance-39.9 mm/mo

Vapour deficit741 Pa

Wind speed5.60 m/s

Cloud cover33.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)